countries bankruptcy system vis a vis key parameters based on the views perceptions of the survey s respondents

Báo cáo hóa học: " A biofeedback cycling training to improve locomotion: a case series study based on gait pattern classification of 153 chronic stroke patients" pdf

Ngày tải lên : 19/06/2014, 08:20

... Patterson and collaborators [24] and, accordingly, only one of these parameters was chosen for the gait patterns categorization: the ST ratio Thus, the two parameters used in the cluster analysis ... training consisted of a 2-week treatment of sessions A visual biofeedback helped the subjects in maintaining a symmetrical contribution of the two legs during pedaling Participants were assessed before, ... effects on cycling and walking ability in chronic stroke patients A case series study was designed and participants were recruited based on a gait pattern classification of a population of 153 chronic...

13
443
0

Báo cáo hóa học: "Research Article A Color Topographic Map Based on the Dichromatic Reﬂectance Model" doc

Ngày tải lên : 21/06/2014, 22:20

... its relevance for various kinds of materials and for several computer vision applications It states that [1] J Serra, Image Analysis and Mathematical Morphology, Academic Press, Orlando, Fla, ... databases (Arborgreens, Australia, and Cambridge) They are as representative as possible of the images generally processed in computer vision applications Indeed, they show various outdoor scenes consisting ... subsets The node CC2 is replaced by two color subsets CS2 and CS3 (c) State of the tree after the extraction of the second color sets At each subsequent stage of the algorithm, the sons at level...

14
343
0

Báo cáo hóa học: " Video Waterscrambling: Towards a Video Protection Scheme Based on the Disturbance of Motion Vectors Yann Bodo" pdf

Ngày tải lên : 23/06/2014, 01:20

... regarding the properties of the human visual system (HVS) increase the energy of the watermark without generating additional visual artifacts Naturally, these possibilities are also Waterscrambling: ... emphasized that 3D approaches generally consider temporal dimension in the same way as spatial ones, although they not hold the same kind of information The same drawback has been noted in the source ... considered as a succession of still images The watermarking payload was initially one bit, but in [20], the authors achieved an embedding of 36 bits /s thanks to the symmetrical phase only matched...

14
580
0

Reliability analysis of a power system based on the multi state system theory

Ngày tải lên : 03/01/2014, 19:38

... capacity of the system is above 22.8 Ah, the system is reliable, though the capacity of a battery is lower than 5700 mAh Suppose the capacity of the first branch is 5600 mAh and the capacity of ... paper, and is compared 97 (1) The reliability of the power system obtained by the traditional system reliability theory is always conservative [5] (2) The power system is a multi-state system The ... 6000} The results show that when the required capacity of the power system is 22.8 Ah, the result gained by the multi-state system theory is larger than the result gained by the traditional system...

4
407
0

Báo cáo khoa học: "a Chat-oriented Dialogue System based on the Vector Space Model" ppt

Ngày tải lên : 07/03/2014, 18:20

... chat-oriented dialogue system that is based on the vector space model framework The system belongs to the class of example -based dialogue systems and builds its chat capabilities on a dual search strategy ... characters who speak and what they said at each dialogue turn On the other hand, context elements contain all the additional information (explanations and descriptions) appearing in the scripts ... first example presented in Table constitutes a serious consistency problem In this case IRIS has reported two different ages in the same chat session The second case, although not so serious as...

6
498
0

Báo cáo hóa học: " Research Article A Stereo Crosstalk Cancellation System Based on the Common-Acoustical Pole/Zero Model" docx

Ngày tải lên : 21/06/2014, 08:20

... Resulted impulse responses after crosstalk cancellation Figure 7: Impulse responses of crosstalk cancellation in the asymmetric case Conclusion This paper investigates crosstalk cancellation ... depicts the impulse responses of the crosstalk cancellation system by the CAPZ method The impulse responses of the HRTFs of 200 taps are shown in Figure 7 (a) , the four crosstalk cancellation ﬁlters ... Performance Evaluation The acoustic transfer function can be estimated based on the positions of loudspeakers and ears Head-related transfer functions (HRTF) provide a measure of the transfer path of...

11
267
0

báo cáo khoa học: " A high-throughput screening system for barley/powdery mildew interactions based on automated analysis of light micrographs" docx

Ngày tải lên : 12/08/2014, 05:20

... detail the image analysis This information is essential to completely understand the functioning of the system in assessing the infection status of transformed cells by haustoria The image analysis ... is controlled by the vendor 's software AxioVision Automation is achieved by a script program which operates AxioVision via its optionally available Visual Basic for Applications (VBA) interface ... expenditure *A number of 100 positions is an average, depending on the actual quantity of transformed cells on the slide tours) As a last step, each segmented object is validated by the haustoria classification...

9
328
0

Development of a graphic user interface based on OpenGL for a drop on demand micro bio fabrication system

Ngày tải lên : 04/10/2015, 15:46

... GUI has established a model containing the information and actions, and also supplied availabilities of operation to a user through visual indicators and graphical icons The actions are usually ... system Related issues which have influences on drop generation are discussed and the vital parameters are identified and investigated Results based on the parameters selection and optimizations ... is the most well-known among these GUI based system in these recent years It is famous for its simple operated and pretty GUI 17 views And there are also some other GUI based systems, such as...

78
383
0

2013 a robust multiple watermarking scheme based on the DWT x

Ngày tải lên : 21/11/2013, 23:58

... the gray scale deformation attac ks such as histogram equalization Figures 9, 11 and 13 provide the SR val ues after watermark extraction from the HH sub-band The SR values reveal also that the ... 13, they a Figures 8, 10 and 12 provide the SR values after watermark re based on applying the same attacks on the Goldhill t extraction from the LL sub-band They show that the SRs of est image ... extracts the watermark from t d in digital he possibly watermarking because of its advantages Keyv observations regarding the obtained scheme simul anpour and ation results Merrikh-Bayat propose...

12
344
0

2013 a robust multiple watermarking scheme based on the DWT

Ngày tải lên : 30/12/2013, 16:22

... deformations and noise addition - The HH sub-bands are robust to nonlinear deformations of the gray scale - Both sub-bands are resistant to rewatermarking - Robustness is enhanced for second level ... watermarks from the LL and HH sub-bands and their appropriate SR after each attack These results suggest that: - The LL sub-bands are most resistant to lossy compression, filtering, geometrical ... test image (b) Watermark used to test robustness against attacks To evaluate the proposed scheme fidelity, we measure the visual quality of the watermarked image using the Peak Signal to Noise...

6
428
0

Tài liệu University Oars Being a Critical Enquiry Into the After Health of the Men Who Rowed in the Oxford and Cambridge Boat-Race, from the Year 1829 to 1869, Based on the Personal Experience of the Rowers Themselves pdf

Ngày tải lên : 14/02/2014, 21:20

... told, sacrifice themselves annually on the altars of our popular pastimes, exist rather in the timid brains of alarmists than in the stern tables of statistical investigation Having thus discussed ... dilatation and its consequences Nevertheless, in the absence of any statistics to the contrary, I strongly suspect that I am an exceptional case, and my aquatic career was not quite analogous to that of ... are spoken of as more or less serious; as having, in fact, sensibly affected the after health A careful analysis of these cases seems to me to shew that if harm really was done by too great a strain...

419
541
0

Tài liệu Ecology and Management of a Forested Landscape Fifty Years on the Savannah River Site pptx

Ngày tải lên : 17/02/2014, 19:20

... of the area The SRS manages its forests on a far longer rotation length than most managed lands in the Southeast Thus, the vast majority of the land area of SRS has suffered relatively minimal ... and probably concentrated along bottomlands and terraces adjacent to streams (Sassaman et al 1990; Sassaman 1993) Sustained seasonal habitation of the area began between 9,800 and 8,000 years ... Terrestrial snakes associated with xeric upland habitats and mesic ﬂoodplain habitats on the Savannah River Site 212 Figure 4.19 Aquatic snakes associated with stream systems and Carolina bays on...

513
1.7K
0

Báo cáo khoa học: Structure of the complex of a yeast glucoamylase with acarbose reveals the presence of a raw starch binding site on the catalytic domain doc

Ngày tải lên : 07/03/2014, 12:20

... Aspergillus niger and A awamori prefer longer malt-oligosaccharides as substrates, which is also the case for S ﬁbuligera glucoamylases [15] The determination of the crystal structure of recom˚ binant ... al site, one acting as general acid and the other as general base [24] The mechanism of hydrolysis consisting of three steps involves proton transfer to the glycosidic oxygen of the scissile bond ... in the ability to digest raw starch While Glu adsorbs to, but does not digest raw starch, Glm adsorbs well to starch granules and is capable of raw starch digestion The glucoamylases from Aspergillus...

11
548
0

Báo cáo khoa học: "A New Statistical Parser Based on Bigram Lexical Dependencies" potx

Ngày tải lên : 08/03/2014, 07:20

... how a backed-off estimation strategy is used for making prepositional phrase attachment decisions The idea is to back-off to estimates based on less context In this case, less context means looking ... tokens of 'of' : E x a m p l e Shaw, based in Dalton, Ga., has annual sales of about $1.18 billion, and has economies o f scale and lower raw-material costs that are expected to boost the profitability ... model rather than treating it as a separate stage This is an area for future research The Parsing Algorithm The parsing algorithm is a simple bottom-up chart parser There is no grammar as such, although...

8
320
0

One dimensional organic nanostructures a novel approach based on the selective adsorption of organic molecules on silicon nanowires

Ngày tải lên : 16/03/2014, 15:35

... closely spaced SiNWs Measurements performed one day after the evaporation of THAP on the surface exhibit the same random adsorption of the THAP molecules on the surface This suggests that even after ... an isolated molecule [15]) Since the thickness of the ONWs is of the order of several ångström, the observed LDOS is a convolution of the LDOS of the SiNWs and that of the adsorbed PQ aggregates ... aggregates Therefore, the contribution of the LDOS of the SiNWs at the proximity of the Fermi level is presumably Fig STM ﬁlled states images of the adsorption of Å of THAP on the SiNWs/Ag(1 0) surface...

5
465
0

Báo cáo khoa học: Atrial natriuretic peptide-dependent photolabeling of a regulatory ATP-binding site on the natriuretic peptide receptor-A pptx

Ngày tải lên : 16/03/2014, 23:20

... NPR -A also appears to regulate fatty acid mobilization [5] NPR -A is a phosphoprotein that contains 1029 amino acids and migrates as a band of % 125 kDa molecular mass under reducing SDS ⁄ PAGE ... undergoes desensitization, which correlates with a loss of phosphate content in the KHD It is suggested that dephosphorylation of the KHD by distinct protein phosphatases [17] occurs as a consequence ... log-transforms for all experiments Finally, antilogs of the corrected log transforms were obtained and used for further testing Statistical analysis was performed by analysis of variance (anova),...

12
338
0

Báo cáo khoa học: Sequences and structural organization of phospholipase A2 genes from Vipera aspis aspis, V. aspis zinnikeri and Vipera berus berus venom Identiﬁcation of the origin of a new viper population based on ammodytin I1 heterogeneity docx

Ngày tải lên : 17/03/2014, 03:20

... CGGTAAGCCCATAACGCCCA CAGGCCAGGATTTGCAGCC CATAAACAYGAGCCAGTTGCC GAGTGGATGCACAGTCGTTG GAAACGGAGGTAGTGACACAT GCCTGCTCGAATTCGGGATG CTCCTTCTTGCACAAAAAGTG CTGCTCGAATTCGGGATG GTCYGGGTAATTCCTATATA GTGATCGAATTTGGGAAGATGATCCA ... also a single nonsense mutation leading to insertion of the TAA stop codon in exon of one of the vaspin A chain genes of V a zinnikeri (data not shown) These four clones are inactive The existence ... intron D similar to that of the V am ammodytes ammodytin I1 gene All PLA2 genes contained a TAA stop codon, an AATAAA polyadenylation site 80 bp downstream from the stop codon, and a TATA-like...

10
451
0

Báo cáo khoa học: "A Novel Discourse Parser Based on Support Vector Machine Classiﬁcation" docx

Ngày tải lên : 30/03/2014, 23:20

... correlations between the relation being classified and relation patterns in either sub-tree, based on theoretical considerations and practical observations The original RST theory suggests the use of ... training and classification Once the features are determined, classification instances can be formally represented as a vector of values in R We use n-fold validation on S and L classifiers to assess ... through a set of binary classifiers, each trained either on a single class (“one vs all”) or by pair (“one vs one”) Recent research suggests keeping the classification whole, with a reformulation of the...

9
390
0

Báo cáo khoa học: "A Mention-Synchronous Coreference Resolution Algorithm Based on the Bell Tree" potx

Ngày tải lên : 31/03/2014, 03:20

... 2003 evaluation data, an ACE-value obtained on the system1 mentions After retrained with Chinese and Arabic data (much less training data than English), the system got and ACE-value on the system ... mentions of ACE 2003 evaluation data for Chinese and Arabic, respectively The results for all three languages are among the top-tier submission systems Details of the mention detection and coreference ... Table shows clearly that these lexical features and the distance features are the most important Sometimes the ACE-value increases after removing a set of features, but the ECM-F measure tracks nicely...

8
403
0

Báo cáo sinh học: " Development of a model for marburgvirus based on severe-combined immunodeficiency mice" doc

Ngày tải lên : 18/06/2014, 18:20

... was assessed daily after infection with the 'scid-adapted' MARV The data are expressed as the average weight of the mice in each group (B) Viral titers were measured using standard plaque assay ... [26-30] As noted here and in other models, the liver and spleen are tissues most consistently affected by MARV, as assessed by gross appearance, microscopy and histology Based on pathology studies of ... transaminase (ALT) and aspartate transaminase (AST) function increased as the MARV disease progressed (Figure 2E–F) As shown by the total Page of 13 (page number not for citation purposes) Virology...

13
456
0