consumers as a source of ideas
integrated product and process design and development the product realization process, second edition (environmental & energy engineering)
... change A classical example is the layout of a typewriter’s keys, which was chosen initially for reasons that have little relevance today, but which cannot be changed As an example of how random ... improvement and think of manufacturing as a system, not as bits and pieces Many companies in Japan embraced his ideas and eventually products made in Japan became synonymous with quality products ... such as analysis of variance and hypothesis testing (see Chapter 11) In addition, Dr Deming taught that by adopting appropriate principles of management, organizations can increase quality and...
- 312
- 2,966
- 0
Báo cáo y học: "Assessing the psychometric properties and the perceived usefulness of the BasisRaadsOnderzoek (BARO) as a first-line screening instrument for juvenile offenders" ppt
... development of the BARO, a standardized screening instrument was not available for CPB workers, resulting in a vast qualitative and quantitative variety of reports As a result, it was not clear why ... the participants that underwent the global screening by means of the BARO as well as the elaborate forensic diagnostic assessment The concurrent validity was based on the correlation of the BARO ... discriminatory value And finally, the CPB workers evaluated the BARO as a useful and practicable instrument The BARO allows the formulation of well-founded advice Internal consistency analysis has...
- 7
- 382
- 0
Introduction to Risk, Return, and the Opportunity Cost of Capital doc
... stock’s variability may be due to many uncertainties, such as unexpected changes in demand, plant manager mortality or changes in costs However, the risks that are not measured by beta are the ... coupon payments can be invested also changes as interest rates change And, of course, the payments are all in nominal dollars, so inflation risk must also be considered b It is true that stocks offer ... attainable portfolio is comprised of Alcan and Nestle Stocks Alcan & BP Alcan & Deutsche Alcan & KLM Alcan & LVMH Alcan & Nestle Alcan & Sony 15 a Portfolio Variance 0.057852 0.082431 0.082871...
- 10
- 608
- 0
maxwell - the price is wrong; understanding what makes a price seem fair and the true cost of unfair pricing (2008)
... held, was based on demand Demand, as cited by both Albert and Aquinas, appears to have meant individual demand, a person’s subjective evaluation of a potential purchase It is the demand of an individual ... discount on any $75 purchase, whereas females were offered only $10 The court dismissed the case, but the reason was not that sex discrimination was accepted, but that the case was based on racketeering ... separate meanings: “acceptable” and “just.”9 Acceptable implies that a fair price is satisfactory Fair in this sense is a preference as in a “fair maid,” “fair weather,” or “fair sailing.” A “just”...
- 259
- 672
- 0
Biological properties and the nutrition value of an Isochrysis strain as a live food for geo-duck larvae
... for strain was f/2 The Isochrysis galbana strain showed a huge range of fatty acids among, contained remarkable amount of PUFA and considerate level of EPA and DHA which play an essential role ... shirai, Katsumi Matumaru, Akio Ohotake, Yoshichika Takamura, Tokujiro Adia and Masayasu Nakano (1989), “Development of a Solid medium for Growth and Isolation of Axenic Microcystis Strains (Cyanobacteria) ... Myristic acid Palmitic Acid Palmitoleic Acid Stearic Acid Oleic Acid Linoleic Acid Anpha-Linoleic Acid Octadecatetraenoic Eicosapentaenoic Acid (EPA) Benhenic acid Docosahexaenoic Acid (DHA) 4.16...
- 5
- 404
- 0
The relative effects of merit pay, bonuses, and long term incenti on future job performance
... performance rating) was used as a control variable Using prior performance as a control variables partials out the effects of stable characteristics that caused employees’ performance (e.g., ability, ... plan that cause it to affect performance levels, not the “name” of the plan It appears that in the company studies by Kahn and Sherer (1990), what was called a merit pay plan was not really a ... smaller than a comparably sized cash award Therefore, from an economic perspective, the liquidity of cash bonuses causes such rewards, on a dollarper-dollar basis, to have a greater present value...
- 35
- 517
- 0
báo cáo hóa học:" Psychometric properties and the prevalence, intensity and causes of oral impacts on daily performance (OIDP) in a population of older Tanzanians" potx
... gender and age Family wealth was assessed as an indicator of socio-economic status in accordance with a standard approach in equity analyses [19] Household durable assets indicative of family wealth ... Swahili language was mandatory (see additional file 1) Kiswahili is the national and official language in Tanzania and almost all (95%) Tanzanians speak the language proficiently A structured interview ... clinical examinations in a shaded area with natural daylight as the source of illumination and with an assistant recording the observations Research assistants for recording were trained and calibrated...
- 11
- 536
- 0
Báo cáo hóa học: " Effects of NiO nanoparticles on the magnetic properties and diffuse phase transition of BZT/NiO composites" potx
... Z, Ang C, Guo R, Bhalla AS: Piezoelectric and strain properties of Ba(Ti1−xZrx)O3 ceramics J Appl Phys 2002, 92:1489-1493 11 Das SR, Choudhary RN, Bhattacharya P, Katiyar RS, Dutta P, Manivannan ... Gobwute Rujijanagul*1 Department of Physics and Materials Science, Faculty of Science, Chiang Mai University, Chiang Mai, 50200, Thailand Faculty of Materials Science, Department of Mechanical Engineering, ... of NiO nanoparticles on the magnetic properties and diffuse phase transition of BZT/NiO composites Parkpoom Jarupoom1, Sukum Eitssayeam1, Kamonpan Pengpat1, Tawee Tunkasiri1, David P Cann2, and...
- 12
- 400
- 0
Báo cáo khoa học: "The relative importance of cork harvesting and climate for stem radial growth of Quercus suber " doc
... rainfall Radial growth was well and inversely correlated with time after harvesting; this group of variables was well described by axis (27% of total variance) Factor explained 13% of total variance, ... variance, and was strongly associated with management, though rather poorly with growth variables The growth rate was high during the first two years (4.0–8.2 mm yr–1), as a new cork layer was ... Caritat A. , Molinas M., Oliva M., El crecimiento radial del alcornoque en cinco parcelas de alcornocal de Girona, Sci ger 18 (1992) 73–83 [2] Caritat A. , Gutiérrez E., Molinas M., Influence of...
- 5
- 316
- 0
Báo cáo y học: "Osteoporosis in experimental postmenopausal polyarthritis: the relative contributions of estrogen deficiency and inflammation" potx
... aided with analysis of data and statistical analysis ME and MV aided with acquisition of data The study was performed mainly by CJ All authors read and approved the final manuscript Acknowledgements ... increased activation of osteoclasts had already ended at this late time point As has been shown previously, the number of B lymphocytes in bone marrow was increased after OVX [25] and decreased ... an established postmenopausal state, whereas Yamasaki and colleagues ovariectomized the rats week after sensitization Systemic inflammation, impaired physical activity, low body mass and treatment...
- 7
- 361
- 0
Báo cáo y học: " Determination of the relative amounts of Gag and Pol proteins in foamy virus particles" doc
... pETpol3 was made alike with #1219 (5'gttatgtgcatatgtgtaataccaaaaaacc) and #1413(5'tgcgctctcgagatttttttccaaatg) All plasmids were sequenced in their FV parts to verify correct insertions and to exclude ... polymerase, and NdeI treatment The PFV pol domain encoding the 85 kD PR, RT, and RNaseH subunits was amplified with primers #1217 (5'tc cacatatgaatcctcttcagctgttacagccgc) and #1414 (5'tattacactcgagcacataacttccttg), ... AdeI, T4 DNA polymerase treatment, and recutting with NdeI A 1.9 kb gag gene (aa 1–625 of 648 aa) was inserted into pET22b (Novagen) inframe to the C-terminal histidine tag after SacI, T4 DNA...
- 7
- 318
- 0
The relative importance of earnings and other information in the valuation of rd intensive firms
... the analyst forecast data are available To control for heteroscedasticity, the variables are scaled by market value of equity Table I, panel A shows that the abnormal earnings persistence parameter ... that the forecast was made for all firms, the sample will be restricted to December 31 year-end firms The analysts’ forecasts are obtained from the I/B/E/S database The analyst forecast for each ... the National Bureau o f Economic Research database from the period 1976 to 1991 The advantage of this database is that the variables are inflation adjusted Hall finds a positive relationship...
- 79
- 273
- 0
On the convergence of relative Pareto efficient sets and the lower semicontinuity of relative Pareto efficient multifunctions
... Clearly, Li An ⊂ Ls An If Ls An ⊂ A ⊂ Li An , then we say that (An ) converges K to A in the sense of Kuratowski-Painlev´e and we denote An −→ A From K closedness of Ls An and Li An imply that ... kinds of relative interior replace for interior of ordering cones This notions is weaker than the classical minimality with respect to a cone and is actually a generalization of weak minimality, ... A. : Parametrized multicriteria optimization: Continuity and closedness of optimal multifunction, J Math Anal Appl., 120 (1986), pp 150–168 25 Sawaragi, Y., Nakayama, H., Tanino, T.: Theory of Multiobjective...
- 25
- 305
- 0
the positive and the negative sides of globalization
... globalization and meanwhile the local government should take measures to combat culture assimilation and sweat workshops This essay is extremely long (338 words instead of the advised 250-265) It has a sound ... that globalization does come with some adverse effects Despite that fact, benefits created by it far outweigh the disadvantages Overall, I am convinced that we should further promote globalization ... your position is clearly expressed, the information is well-organized, and structure-wise the sentences are fine The vocabulary is impressive and there were only a few grammatical errors (see comments...
- 2
- 537
- 1
Some register features in agreement between the united states of america and the socialist republic of vietnam on trade relations = một số đặc điểm ngữ vực trong hiệp định thương mại việt mỹ
... the Socialist Republic of Vietnam) etc: e.g.: et cetra For example i.e.: That is to say Et.al: and others WTO: World Trade Organization ASEAN: Association of Southeast Asian Nations Vietnam: The ... affects and determines features of the language The aspect of the language used is at a degree of formality, accuracy, clearness and technicality of linguistics exchanges As the choice of vocabulary ... variables of Field, Tenor, and Mode, and is a useful abstraction which relates variations of language use to variations of social context The change of variations leads to the change of meanings...
- 48
- 568
- 5
Tài liệu McGraw.Hill.Stock Options And The New Rules Of Corporate Accountability doc
... design and implement executive compensation packages that are based on performance? How can ownership in a corporation be used as a reward after performance is demonstrated instead of as a perk that ... press, the Financial Accounting Standards Board (FASB) and its London-based counterpart, the International Accounting Standards Board (IASB), are drafting and finalizing proposed rules that will require ... Protestant ethic that underscores our association of the spiritual and the economic, there’s little surprise that Rakesh Khurana, an assistant professor of organizational behavior at Harvard Business...
- 225
- 600
- 2
Tài liệu AGREEMENT BETWEEN THE UNITED STATES OF AMERICA AND THE SOCIALIST REPUBLIC OF VIETNAM ON TRADE RELATIONS ppt
... that all measures of general application affecting trade in services are administered in a reasonable, objective and impartial manner A Each Party shall maintain or institute as soon as practicable ... transition and is taking steps to integrate into the regional and world economy by, inter alia, joining the Association of Southeast Asian Nations (ASEAN), the ASEAN Free Trade Area (AFTA), and ... security, and shall in no case accord treatment less favorable than that required by applicable rules of customary international law Each Party shall in no way impair by unreasonable and discriminatory...
- 156
- 809
- 1
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng 9 tr 25