conjugate addition of enolates is a powerful synthetic transformation

Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx

Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx

Ngày tải lên : 19/02/2014, 05:20
... GCGGGATCCGTGAATAATCTGCACCCTCGA ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT GCGGGATCCCTCAGCCCATTGGAAGGCACC ATAAGAATGCGGCCGCTCAGCTGTCACTCAGCCGCAGCAG GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAGTCTGAGGTGATAACATTCCC ... GCGAAGCTTCACGATGTCTCACACCATTT GCGGGATCCCGTTTCCCAGCCTGTTGGGCCT AAACTGCAGGATGGCGGACATCTCCCTGGAC AAACTGCAGAAGCTTGATTTTGAATTCTGT AAACTGCAGGATGGCGGACATCTCCCTGGAC AAACTGCAGAAGCTTGATTTTGAATTCTGT GCGAAGCTTCACGATGCCCAAGAAGAAGCCGACGCC ... GCGAAGCTTCACGATGCCCAAGAAGAAGCCGACGCC GCGGGATCCCGGATGCTGGCAGCGTGGGTTGG GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT GCGGGATCCCTCAGCCCATTGGAAGGCACC ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT...
  • 14
  • 517
  • 0
Báo cáo khoa học: Inactivation of phosphorylase is a major component of the mechanism by which insulin stimulates hepatic glycogen synthesis doc

Báo cáo khoa học: Inactivation of phosphorylase is a major component of the mechanism by which insulin stimulates hepatic glycogen synthesis doc

Ngày tải lên : 31/03/2014, 01:20
... preparations indicated Statistical analysis was by Student’s paired t test Fig Time course of inactivation of phosphorylase a (A) and activation of glycogen synthase (B) by 10 nM insulin Hepatocytes ... phosphorylase is associated with both activation and translocation of glycogen synthase, and that the former mechanism alone cannot explain the stimulation of glycogen synthesis This suggests that translocation ... phosphatase This reverses the inhibition of synthase phosphatase by phosphorylase a There is a long-standing debate as to whether inactivation of phosphorylase is a component of the mechanism by...
  • 9
  • 381
  • 0
báo cáo hóa học:" Sang Froid in a time of trouble: is a vaccine against HIV possible?" pot

báo cáo hóa học:" Sang Froid in a time of trouble: is a vaccine against HIV possible?" pot

Ngày tải lên : 20/06/2014, 08:20
... that are highly efficacious They are almost always needed for inactivated vaccines, e.g tetanus, diphtheria, and polysaccharide conjugates (exceptions are hepatitis A and hepatitis B), and are often ... genital tract [115], and there is recent work suggesting that sublingual administration of antigens may be a way around compartmentalization of mucosal immunity [116] (see table 7) Page of 12 (page ... rotavirus vaccine This was an orally administered mixture of a simian rotavirus and reassortants of human and simian rotaviruses in which the simian virus contributed 10 of the 11 double-stranded...
  • 12
  • 419
  • 0
Báo cáo y học: " Colour of sputum is a marker for bacterial colonisation in chronic obstructive pulmonary disease" pps

Báo cáo y học: " Colour of sputum is a marker for bacterial colonisation in chronic obstructive pulmonary disease" pps

Ngày tải lên : 12/08/2014, 11:21
... presence of bacterial colonisation and high bacterial load were a more severe degree of dyspnoea and a darker colour of sputum The degree of dyspnoea is a marker of severity of COPD and being a categorical ... interpretation of data and wrote the manuscript EM, JM and AT designed the study, and participated in the analysis and interpretation of data AM and SV recruited the patients, collected data and participate ... speculate that change in bacterial load was unlikely to be a major primary mechanism of exacerbation induction in COPD [27,28] This hypothesis is a matter of debate, because the interpretation of...
  • 9
  • 395
  • 0
Glial cell line drived neurotrophic factor (GDNF) family of ligands is a mitogenic agent in human glioblastoma and confers chemoresistance in a ligand specific fashion

Glial cell line drived neurotrophic factor (GDNF) family of ligands is a mitogenic agent in human glioblastoma and confers chemoresistance in a ligand specific fashion

Ngày tải lên : 14/09/2015, 12:13
... mitotic activity, vascular thrombosis, microvascular proliferation and necrosis Similar to anaplastic astrocytoma, glioblastoma may arise de novo as glioblastoma or may transform from diffuse astrocytoma ... prognosis of the disease The mean time to progression is years and the mean survival is years13-15 Glioblastoma is the most common astrocytoma, accounting for approximately 12-15% of all intracranial ... potentiate adjuvant therapy It is likely that the chemoresistance properties are potentiated by autocrine and paracrine pathways and facilitated by mitogenic agents Local tissue invasion distinguishes...
  • 203
  • 290
  • 0
Báo cáo y học: "Excess circulating angiopoietin-2 is a strong predictor of mortality in critically ill medical patients"

Báo cáo y học: "Excess circulating angiopoietin-2 is a strong predictor of mortality in critically ill medical patients"

Ngày tải lên : 25/10/2012, 10:31
... Minneapolis, USA) This assay measures biologically active VEGF121 and VEGF165 Statistical analysis Differences between patients and healthy controls were evaluated using a non-parametric Kruskal-Wallis test ... coefficient and linear regression analysis was performed after logarithmic transformation of Ang-2 values (logAng-2) The primary outcome studied was 30-day survival and was calculated from the day of ... Critical Care Vol 12 No Kümpers et al package (SPSS Inc., Chicago, IL, USA) and the GraphPad Prism software (GraphPad Prism Software Inc San Diego, California, USA) Figure Results Decreased Ang-1 and...
  • 9
  • 634
  • 0
Báo cáo y học: "Eosinopenia is a reliable marker of sepsis on admission to medical intensive care units"

Báo cáo y học: "Eosinopenia is a reliable marker of sepsis on admission to medical intensive care units"

Ngày tải lên : 25/10/2012, 10:35
... 51:189-197 A ssaoui Y, Zeggwagh AA, Zekraoui A, Abidi K, Abouqal R: Validation of a behavioral pain scale in critically ill, sedated, and mechanically ventilated patients Anesth Analg 2005, 101:1470-1476 ... diagnosis of sepsis on admission to the ICU Eosinopenia may become a helpful clinical tool in ICU practices interpretation of data, and gave the final approval of the manuscript All authors read ... of data NM helped to draft the manuscript, and participated in the acquisi- Page of 10 (page number not for citation purposes) tion of data AZ participated in the coordination of the study AAZ...
  • 10
  • 597
  • 0
Getting Started With ASP.NET ASP.NET is a new and powerful technology for writing dynamic web pages.

Getting Started With ASP.NET ASP.NET is a new and powerful technology for writing dynamic web pages.

Ngày tải lên : 06/11/2013, 00:15
... Windows NT and many Unix versions, and it can be built as an Apache module and as a binary that can run as a CGI When built as an Apache module, PHP is especially speedy A downside is that you have ... than Java, and also you don't have to worry about integrating different languages into the page, as Curl is capable of providing the same features as both Java and JavaScript 16 Getting Started ... support via something known as the Java Virtual Machine (JVM), and there are several standard and non-standard tags that are used to add Java applets to a web page These tags tell...
  • 792
  • 596
  • 0
Tài liệu .An ARCO Book ARCO is a registered trademark of Thomson Learning, Inc., and is used herein under pptx

Tài liệu .An ARCO Book ARCO is a registered trademark of Thomson Learning, Inc., and is used herein under pptx

Ngày tải lên : 20/01/2014, 20:20
... Graduate Management Admission Test, which is a standardized exam given at various locations in the United States and Canada and around the world Throughout North America and in many international ... these arguments differ from that of the stem paragraph (A) is a valid argument: Given anything that is a war, if any war is to be condemned, then all wars are to be condemned (B) is not a valid argument ... as wide of a margin as any candidate in the state’s history (A) she was reelected with as wide of a margin as any candidate in the state’s history (B) she had been reelected with as wide of a...
  • 696
  • 1K
  • 1
Tài liệu Chiếu sáng trong truyền hình - Television Lighting Television is a means of changing pptx

Tài liệu Chiếu sáng trong truyền hình - Television Lighting Television is a means of changing pptx

Ngày tải lên : 26/01/2014, 04:20
... within a scene have the same color temperature A combination of filters and electronic adjustments is used to adapt color cameras to each new lighting situation Most cameras can adjust automatically ... or black level, of zero IRE, rather than the 7.5 IRE broadcast standard Some cameras that automatically boost the signal in low light situations can also be run in manual mode where you can control ... practice, actual contrast ranges are rarely measured using a meter A subjective analysis based on camera output is generally sufficient Color Temperature The third consideration is color temperature...
  • 6
  • 463
  • 1
Learning english is a piece of cake 1

Learning english is a piece of cake 1

Ngày tải lên : 27/01/2014, 20:11
... English is difficult and it’s hard to memorize new words ðeɪ θɪŋk ˈɪŋ ɡlɪʃ ɪz ˈdɪfɪk əlt ænd ɪts hɑːrd tə ˈmem ə raɪz njuː wɜːdz and grammatical rules In fact, learning English can be a piece of ... ˈeɪʃ ən doʊnt ˈ wɝːɪ ə ˈbaʊt ˈɡræm ə Don’t be afraid of making mistakes Just try to speak doʊnt biː ə ˈfreɪd ʌv ˈmeɪk ɪŋ mɪ ˈsteɪk dʒʌst traɪ tuː spiːk Speak English as much as possible spiːk ˈɪŋ ...  In fact, she is a sales person! “Improve” = cải thiện, cải tiến I want to improve my English! Many people are worried about learning English ˈmen i ˈpiːpl ɑːr ˈwʌrid ə ˈbaʊt ˈlɝːn ɪŋ...
  • 2
  • 1.7K
  • 15
Tài liệu Báo cáo khoa học: The Arabidopsis protein kinase Pto-interacting 1-4 is a common target of the oxidative signal-inducible 1 and mitogen-activated protein kinases docx

Tài liệu Báo cáo khoa học: The Arabidopsis protein kinase Pto-interacting 1-4 is a common target of the oxidative signal-inducible 1 and mitogen-activated protein kinases docx

Ngày tải lên : 14/02/2014, 19:20
... AGATTTTACGC-3 and 5-AACTGGTGAAGCGGAAG AGAC-3, PTI1-4 (At2g47060): 5-CCCCAAAGAAAATG AGTTGCT-3 and 5-GCATCATTTCCTGGAGGAAAG-3 Acknowledgement This project was supported by grants from the Austrian Science ... gene as an internal standard PCRs were performed using the following primers: ACT2 (At3g18780): 5-ACATTGT GCTCAGTGGTGGA-3 and 5-CTGAGGGAAGCAAG AATGGA-3, OXI1 (At3g25250): 5-GACGAGATTATC AGATTTTACGC-3 ... Matsuoka D, Nanmori T, Sato K, Fukami Y, Kikkawa U & Yasuda T (2002) Activation of AtMEK1, an Arabidopsis mitogen-activated protein kinase kinase, in vitro and in vivo: analysis of active mutants expressed...
  • 11
  • 700
  • 0
Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf

Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf

Ngày tải lên : 15/02/2014, 01:20
... structure of Met8P has shown that this protein has an aspartate residue (Asp141), which is important for both chelatase and dehydrogenase function [17]; interestingly, this aspartate, Asp129, is also ... biosynthetic pathway, for example, oxidation of C17 propionate to give an acrylate side chain This type of step would normally require FAD-based chemistry Another potential dehydrogenation is NAD ⁄ NADP-dependent ... SDS ⁄ PAGE for western analysis by using the alkaline phosphatase conjugate of strep-tactin antibody, we found that both membrane and cytoplasmic fractions were free of NirF protein and it was present...
  • 12
  • 613
  • 0
Tài liệu Báo cáo khoa học: Top-down MS, a powerful complement to the high capabilities of proteolysis proteomics pdf

Tài liệu Báo cáo khoa học: Top-down MS, a powerful complement to the high capabilities of proteolysis proteomics pdf

Ngày tải lên : 18/02/2014, 16:20
... RNase A deamidation samples of Fig Deamidation at an individual residue of a specific product causes a Da increase in any fragment ion containing that residue The average mass gain of N-terminal ... error that does not affect the molecular mass value and a sequence consistent with those of sheep and human carbonic anhydrases A thaliana [20], molecular ions representing a 5% component gave a molecular ... molecular mass value that is the same as that predicted is not a guarantee that the predicted sequence is correct In an early (1993) example of top-down identification [23], our measured molecular mass...
  • 13
  • 572
  • 0
Tài liệu What is a high school worth?: A model of Australian private secondary school fees docx

Tài liệu What is a high school worth?: A model of Australian private secondary school fees docx

Ngày tải lên : 20/02/2014, 19:20
... program An alternative to either of these is the International Baccalaureate (IB) and a small number of schools, mainly private, offer the IB diploma Table reports some standard VCE statistics across ... (bas) It is a group of schools in Ballarat, that provides the basis for interschool sporting competition Ballarat and Clarendon College; Ballarat and Queens Anglican Grammar School; Ballarat ... English Attendance ICSEA Number of Teachers Number of Support Staff Read7 Write7 Spell7 Grammar7 Math7 School Associations: ASPV AGSV GV ACC ACOED BAS CAS Sandhurst EID GIS SIS Region: Cental East...
  • 24
  • 511
  • 0
Tài liệu Báo cáo khoa học: "TREATMENT OF LONG DISTANCE DEPENDENCIES IN LFG AND TAG: FUNCTIONAL UNCERTAINTY IN LFG IS A COROLLARY IN TAG" ppt

Tài liệu Báo cáo khoa học: "TREATMENT OF LONG DISTANCE DEPENDENCIES IN LFG AND TAG: FUNCTIONAL UNCERTAINTY IN LFG IS A COROLLARY IN TAG" ppt

Ngày tải lên : 21/02/2014, 20:20
... where sy is a string in a, or f = v and e E a The functional uncertainty approach may be characterized as a localization of the long distance dependencies; a localization at the level of fstructures ... This is the same analysis as given by LFG In a TAG, the dependent items are part of the same elementary tree Features of these nodes can be related locally within this elementary tree (as in a ... defined a restricted version of FTAG, called RFTAG, that can generate only TALs (the languages generated by TAGs) In RFTAG, we insist that the feature structures that are associated with nodes are...
  • 8
  • 608
  • 0
Báo cáo khoa học: Cardiac ankyrin repeat protein is a marker of skeletal muscle pathological remodelling pot

Báo cáo khoa học: Cardiac ankyrin repeat protein is a marker of skeletal muscle pathological remodelling pot

Ngày tải lên : 07/03/2014, 03:20
... TCAGAGTTCCCTACCGAAGCAG MH181PO.F: CTCCAAGCAGATGCAGCAGA M225PO.P: CCGTGGTGCTGATGGGCAAGAA M267PO.R: ACCATGATGCGCAAGGCCAT 1584p21.F: GTACAAGGAGCCAGGCCAAG 1629p21.P: TCACAGGACACTGAGCAATGGCTGATC 1691p21.R: ... CGCACTGTAAGACCCCAACA 6mC9.F: TCTGCACCCTCACCGTCTTC 58mC9.P: TCTCGAAGATATGACTCCAGGACCACAATATTTTCT 135mC9.R: GGCTTCCATGGCATACTCCA 616mCARP.F: CTTGAATCCACAGCCATCCA 641mCARP.P: CATGTCGTGGAGGAAACGCAGATGTC 706mCARP.R: ... 423mMLCfast.P: ACCGATTTTCCCAGGAGGAGATCAAGAA 500mMLCfast.R: TCTTGTAGTCCACGTTGCCG 381mMLC-2V.F: GAAGGCTGACTATGTCCGGG 403mMLC-2V.P: ATGCTGACCACACAAGCAGAGAGGTTCTC 461mMLC-2V.R: GCTGCGAACATCTGGTCGAT 958mMurf1.F...
  • 16
  • 428
  • 0