condition for a rectangular co ordinate a mass balance on the control volume figure 3 4 gives

Conversion of saline water to fresh water using air gap membrane distillation (AGMD)

Conversion of saline water to fresh water using air gap membrane distillation (AGMD)

Ngày tải lên : 11/09/2015, 09:57
... inlet cocentration 133 Power consumption, water quality and membrane condition 135 5 .3. 1 Power consumption 135 5 .3. 2 Water quality 136 5 .3. 3 Membrane condition 5 .3 Experiments with multi-stage ... membrane 73 vi 3. 1 .3. 3 Heat transfer through membrane support 74 3. 1 .3. 4 Heat transfer through air gap 74 3. 1 .3. 5.Heat transfer during condensation 75 3. 1 .3. 6.Heat transfer through coolant plate and ... unit 137 Simulation and validation 138 5 .4 5 .4. 1 Theoretical calculations of temperature and comparison with experimental 138 experimental value 5 .4. 2 Validation of membrane and air gap transport...
  • 248
  • 646
  • 0
Báo cáo hóa học: " Global attractor of the extended FisherKolmogorov equation in Hk spaces" pot

Báo cáo hóa học: " Global attractor of the extended FisherKolmogorov equation in Hk spaces" pot

Ngày tải lên : 20/06/2014, 22:20
... to the anonymous referees whose careful reading of the manuscript and valuable comments enhanced presentation of the manuscript Foundation item: the National Natural Science Foundation of China ... a global attractor A ⊂ Xα which attracts any bounded set of Xa in the Xa-norm For Equation (2.1) with variational characteristic, we have the following existence theorem of global attractor [20,22] ... which generates an analytic semigroup etL It is known that there exists a constant l ≥ such that L - lI generates the fractional power operators Lα and fractional order spaces Xa for a Î R1, where...
  • 10
  • 314
  • 0
THE COMPLEX MONGEAMPERE EQUATION IN ` DOMAIN OF C n

THE COMPLEX MONGEAMPERE EQUATION IN ` DOMAIN OF C n

Ngày tải lên : 14/10/2015, 08:01
... E Bedford and B A Taylor, A new capacity for plurisubharmonic functions Acta Math., 149 (1982), 1 41 [4] Z Blocki, The domain of definition of the complex Monge-Amp`ere operator, Amer J Math., ... compactification of Cn , A for the Fclosure of A and ∂F A for the F-boundary of A We denote by F-P SH(Ω) the set of F-plurisubharmonic functions on an F-open set Ω We say that u is F-maximal if for ... plurisubharmonic functions without changing the Monge-Amp`ere measures and applications, Ann Polon Math., 112 (20 14) , no 1, 55–66 [12] L M Hai, N V Trao and N X Hong, The complex Monge-Amp`ere equation in unbounded...
  • 8
  • 179
  • 0
Tài liệu Đề tài " Global well-posedness and scattering for the energy-critical nonlinear Schr¨odinger equation in R3 " docx

Tài liệu Đề tài " Global well-posedness and scattering for the energy-critical nonlinear Schr¨odinger equation in R3 " docx

Ngày tải lên : 16/02/2014, 06:20
... validated with straightforward computations Lemma 2 .3 (Local conservation of mass and momentum) If φ is a (Schwartz ) solution to (2.1) then there exist the local mass conservation identity (2 .4) ... stage: Localization control on u 4 .3 Second stage: Localized Morawetz estimate 4. 4 Third stage: Nonconcentration of energy Frequency delocalized at one time =⇒ spacetime bounded Small L6 norm at ... solution’s L2 mass Specifically, we prove a frequency localized L2 mass estimate that gives us information for longer time intervals than seem to be available from the spatially localized mass conservation...
  • 100
  • 434
  • 0
Tài liệu Báo cáo khoa học: Oligomerization of the Mg2+-transport proteins Alr1p and Alr2p in yeast plasma membrane pptx

Tài liệu Báo cáo khoa học: Oligomerization of the Mg2+-transport proteins Alr1p and Alr2p in yeast plasma membrane pptx

Ngày tải lên : 19/02/2014, 06:20
... ATTTTTATGAGAAAACGTGAAAAAACTTC GTAATGTCGTCCTTATCGTACGCTGCA GGTCGAC AAAGATCTGCCGACCTACCATAGCGGTC ATGTTAATTGTAACGGCATCGATGAATT CGAGCTCG TTCGAAAAATGCAGCATT TCTACAAAAGCCCTCCTACC CCAGGAGAGAATTCAAGTATTGC B C ALR1 ALR-c36 ... ATGCGGCCGCGTCGACGATTGTAACG TTTCTGCAGGAGCTCGAAAAATGCA GCATTTGG AAACTGCAGGATTGTAACGGCTATAT CTAC CAGGGTATGGATGAAACGGTTGC TGATCCCGAAGTGGAAGTAGAGC TTAAGTTCTAATGCGAGGCCATCC TTCGTTCACTGTGCCTTTGATGG ACCAAGAGAGGTATCTTGACTTTACG ... (5¢) to 3 ) A AAAGCGACTAGTCATTTTACCATG TGTTTCGTCGACGCAAGAAGCTCG TTCTGTCGACCCAATAGCTGG ATTAATCCGGTCGACTAACATTCATACC TTAAAGTCGACCTAAGTAGTTTGTATGG AAAGTCGACTGTCGTAGCGGC B1-linker-ATGTCATCATCCTCAAGTTC...
  • 14
  • 607
  • 0
Tài liệu Báo cáo khoa học: Hyperactive antifreeze protein in flounder species The sole freeze protectant in American plaice docx

Tài liệu Báo cáo khoa học: Hyperactive antifreeze protein in flounder species The sole freeze protectant in American plaice docx

Ngày tải lên : 20/02/2014, 01:20
... prediction program Sequence Source XIDPAARAAAAA IDPAAKAAAAA SIDPGTKAASAA NIDPAVKAAAA Winter flounder AFP 5a hypothetical gene product American plaice AFP Yellowtail flounder AFP 44 42 60.6 9 .3 4. 2 6.6 4. 1 ... at equivalent concentrations The thermal hysteresis activity of American plaice plasma as a function of concentration shows the usual rectangular hyperbolic shape at high concentrations but the ... (A) Fractionation of American plaice plasma on a Sephadex G-75 column (B) Refractionation of pooled active AFP fractions from (A) on Sephadex G-75 Absorbance at 230 nm (black dot) and thermal...
  • 11
  • 469
  • 0
Tài liệu Báo cáo khoa học: Reconstitution of coupled fumarate respiration in liposomes by incorporating the electron transport enzymes isolated from Wolinella succinogenes docx

Tài liệu Báo cáo khoa học: Reconstitution of coupled fumarate respiration in liposomes by incorporating the electron transport enzymes isolated from Wolinella succinogenes docx

Ngày tải lên : 21/02/2014, 03:20
... treated in the same way as described above The reaction was started by the addition of fumarate instead of DMN, and the consumption of fumarate was recorded in a separate experiment in the absence of ... TACGATCCCGTTCAGCTAGC -3 , and for mutant Q 131 L: 5Â- (36 49 )GGGTTTACAATCCCGTTCTCCTA GCAGCCTATATGGG -3 ) Altered nucleotides are printed in bold, and the corresponding codons are underlined The numbers in parentheses ... TPP+ was taken up by the proteoliposomes, and was released into the medium again after consumption of fumarate The cycle could be repeated by a second addition of fumarate TPP+ uptake was abolished...
  • 10
  • 569
  • 0
Báo cáo khoa học: Isothermal unfolding studies on the apo and holo forms of Plasmodium falciparum acyl carrier protein Role of the 4¢-phosphopantetheine group in the stability of the holo form of Plasmodium falciparum acyl carrier protein docx

Báo cáo khoa học: Isothermal unfolding studies on the apo and holo forms of Plasmodium falciparum acyl carrier protein Role of the 4¢-phosphopantetheine group in the stability of the holo form of Plasmodium falciparum acyl carrier protein docx

Ngày tải lên : 16/03/2014, 10:20
... DGwater apo-ACP (kcalặmol)1) 2 83 288 2 93 298 30 3 31 3 31 8 32 3 32 8 33 3 3. 95 3. 91 3. 88 3. 83 3.92 3. 62 3. 68 3. 74 3. 61 3. 58 3. 56 3. 48 3. 46 3. 37 3. 59 3. 35 3. 49 ND 3. 31 3. 27 ) ) ) ) ) ) ) ) ) ) ) 1 .31 ) ... DGwater 33 0 34 0 260 32 0 30 0 280 Temperature [K] 34 0 280 FEBS Journal 2 74 (2007) 33 133 326 ê 2007 The Authors Journal compilation ê 2007 FEBS 290 32 0 30 0 31 0 Temperature [K] 33 0 34 0 33 19 Plasmodium ... apo-ACP and holo-ACP on a MonoQ HR anion exchange column Peak 1: apo-ACP Peak 2: holo-ACP (G) Separation of apo-ACP and holo-ACP; 12% native PAGE showing the separation of apo-ACP and holo-ACP...
  • 14
  • 419
  • 0
Báo cáo "Quantum kinetic equation in the quantum hadrondynamics (QHD-I) model " pptx

Báo cáo "Quantum kinetic equation in the quantum hadrondynamics (QHD-I) model " pptx

Ngày tải lên : 22/03/2014, 11:20
... kinetic analysis is implemented directly in real-time and clearly establishes the relation between the interaction rate in the relaxation time approximation and the damping rate of the mean field ... The Feynman diagrams contribute to the kinetic equation for fermion’s interaction up to two loop order The bold solid line is the fermion propagator S, the only solid line is the scalar propagator ... Discussion and conclusion In the above mentioned sections the real time formalism was used to study the fermion propagator in the matter modeled by the QHD-I model It could eventually be used in other...
  • 10
  • 165
  • 0
steinmetz cp  discussion on 'the effect of iron in distorting alternating-current wave-form

steinmetz cp discussion on 'the effect of iron in distorting alternating-current wave-form

Ngày tải lên : 04/06/2014, 12:44
... not consider the parabolic law of magnetic induction: H B-Il a+ bH as an empirical law, however, but rather as a rational equation approximating the B-H curve, and the deviations of the induction ... picture of a formula and not as a representation of physical actions For my part I prefer to limit the vector diagram to the representation of physical action and I always use the idea of a rotating ... or star connection, the secondaries in delta, the primary exciting current does not contain any third harmonic, but the triple FIG 10 harmonic of excitation circulates in the secondary transformer...
  • 20
  • 439
  • 0
Báo cáo hóa học: " A fixed point approach to the Hyers-Ulam stability of a functional equation in various normed spaces" pptx

Báo cáo hóa học: " A fixed point approach to the Hyers-Ulam stability of a functional equation in various normed spaces" pptx

Ngày tải lên : 20/06/2014, 22:20
... equation J Inequal Appl 2011 (2011) Article ID 19 43 9 4 13 Kenary, HA: On the Hyers-Ulam-Rassias stability of a functional equation in non-Archimedean and random normed spaces Acta Universitatis Apulensis ... Hyers-Ulam-Rassias stability of approximately additive mappings J Math Anal Appl 1 84, 43 1 – 43 6 (19 94) doi:10.1006/jmaa.19 94. 1211 Skof, F: Local properties and approximation of operators Rend Sem Mat ... have the Archimedean property Let us consider a valuation which satisfies a stronger condition than the triangle inequality If the triangle inequality is replaced by |r + s| ≤ max{|r|, |s|} for...
  • 14
  • 479
  • 0
Báo cáo hóa học: " On the stability of an AQCQ-functional equation in random normed spaces" potx

Báo cáo hóa học: " On the stability of an AQCQ-functional equation in random normed spaces" potx

Ngày tải lên : 21/06/2014, 01:20
... 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 Gajda, Z: On stability of additive mappings Int J Math Math Sci 14, 43 1 – 43 4 (1991) doi:10.1155/S016117129100056X Aczel, ... that the function f(x) = x4 satisfies the functional equation (1 .3) , which is called a quartic functional equation (see also [33 ]) In addition, Kim [ 34 ] has obtained the Hyers-Ulam stability for ... jmsj/002100 64 Găvruta, P: A generalization of the Hyers-Ulam-Rassias stability of approximately additive mappings J Math Anal Appl 1 84, 43 1 – 43 6 (19 94) doi:10.1006/jmaa.19 94. 1211 Hyers, DH, Isac, G, Rassias,...
  • 12
  • 395
  • 0
báo cáo hóa học: " On the stability of pexider functional equation in non-archimedean spaces" pot

báo cáo hóa học: " On the stability of pexider functional equation in non-archimedean spaces" pot

Ngày tải lên : 21/06/2014, 02:20
... functional equations in non-Archimedean spaces Appl Anal Discrete Math 1, 32 5 33 4 (2007) doi:10.2298/AADM070 232 5M Najati, A, Moradlou, F: Hyers-Ulam-Rassias stability of the Apollonius type quadratic ... linear functional equation Proc Nat Acad Sci USA 27, 222–2 24 (1 941 ) doi:10.10 73/ pnas.27 .4. 222 Aoki, T: On the stability of the linear transformation in Banach spaces J Math Soc Jpn 2, 64 66 ... Hadronic Press, Palm Harbor (2001) Rassias, TM: On the stability of functional equations and a problem of Ulam Acta Appl Math 62, 23 130 (2000) doi:10.10 23 /A: 100 649 92 235 72 Rassias, THM: Functional...
  • 11
  • 325
  • 0
báo cáo hóa học: " An initial-boundary value problem for the one-dimensional non-classical heat equation in a slab" potx

báo cáo hóa học: " An initial-boundary value problem for the one-dimensional non-classical heat equation in a slab" potx

Ngày tải lên : 21/06/2014, 02:20
... Matemática, Universidad Austral, Paraguay 1950, S2000FZF Rosario, Argentina 4Facultad de Ingenier a, Universidad Nacional de Salta, Buenos Aires 144 , 44 00 Salta, Argentina Salva et al Boundary ... One-dimensional heat conduction with a class of automatic heat source controls IMA J Appl Math 40 , 205–216 (1998) Kenmochi, N: Heat conduction with a class of automatic heat source controls Pitman Research ... Briozzo, AC, Tarzia, DA: A one-phase Stefan problem for a non-classical heat equation with a heat flux condition on the fixed face Appl Math Comput 182, 809–819 (2006) doi:10.1016/j.amc.2006. 04. 043 ...
  • 17
  • 520
  • 0
Báo cáo hóa học: " Study of the vertical transport in p-doped superlattices based on group III-V semiconductors" pdf

Báo cáo hóa học: " Study of the vertical transport in p-doped superlattices based on group III-V semiconductors" pdf

Ngày tải lên : 21/06/2014, 05:20
... the 2DHG, is the main reason for the realization of our calculations in cubic phase; the PZ fields can decrease drastically the dispersion relation and consequently the conductivity [17,18] The ... quasi-classical transport theory based on Boltzmann’s equation with the collision integral taken within the relaxation time approximation, the conductivity for vertical transport in SL minibands ... been adopted [19] Results and discussion Figure 2a shows the conductivity for heavy holes (s as a function of the two-dimensional acceptor concentration, N2D, for unstrained GaAs/Al0.3Ga0.7As SLs...
  • 6
  • 360
  • 0
Báo cáo hoa học: " On the stability of a mixed type functional equation in generalized functions" ppt

Báo cáo hoa học: " On the stability of a mixed type functional equation in generalized functions" ppt

Ngày tải lên : 21/06/2014, 20:20
... Functional Equations and Inequalities with Applications Springer, New York (2009) [8] Towanlong, W, Nakmahachalasint, P: An n-dimensional mixed-type additive and quadratic functional equation and ... functional equation Math Inequal Appl 9, 1 53 165 (2006) [12] Kannappan, Pl, Sahoo, PK: On generalizations of the Pompeiu functional equation Int J Math Math Sci 21, 117–1 24 (1998) [ 13] Najati, A, ... solutions of the heat equation as a special case of the results as in [ 24] In this case, the condition (i) in the above theorem is replaced by the following: For every ε > there exists a positive constant...
  • 21
  • 299
  • 0
Báo cáo hóa học: " Research Article New Trace Bounds for the Product of Two Matrices and Their Applications in the Algebraic Riccati Equation" potx

Báo cáo hóa học: " Research Article New Trace Bounds for the Product of Two Matrices and Their Applications in the Algebraic Riccati Equation" potx

Ngày tải lên : 22/06/2014, 02:20
... algebraic Riccati equations applied to automatic control, ” Chaos, Solitons & Fractals, vol 32 , no 2, pp 48 7 49 5, 2007 M.-L Ni, “Existence condition on solutions to the algebraic Riccati equation,” ... matrix product,” IEEE Transactions on Automatic Control, vol 52, no 2, pp 34 9 35 2, 2007 15 F Zhang and Q Zhang, “Eigenvalue inequalities for matrix product,” IEEE Transactions on Automatic Control, ... Riccati and Lyapunov equation”,” IEEE Transactions on Automatic Control, vol 33 , no 11, pp 1088–1091, 1988 11 J B Lasserre, A trace inequality for matrix product,” IEEE Transactions on Automatic...
  • 18
  • 456
  • 0
Báo cáo hóa học: " Research Article Stability of a Quadratic Functional Equation in the Spaces of Generalized Functions" docx

Báo cáo hóa học: " Research Article Stability of a Quadratic Functional Equation in the Spaces of Generalized Functions" docx

Ngày tải lên : 22/06/2014, 02:20
... distributions,” Journal of Mathematical Analysis and Applications, vol 295, no 1, pp 107–1 14, 20 04 13 J Chung, A distributional version of functional equations and their stabilities,” Nonlinear Analysis: ... On the general solution of a functional equation in the domain of distributions,” Aequationes ¨ Mathematicae, vol 3, pp 236 – 246 , 1969 E L Koh, The Cauchy functional equations in distributions,” ... Th M Rassias, Stability of Functional Equations in Several Variables, Progress in Nonlinear Differential Equations and Their Applications, 34 , Birkh¨ user, Boston, Mass, USA, 1998 a 12 Journal of...
  • 12
  • 311
  • 0
Báo cáo hóa học: " Research Article Stability of Cubic Functional Equation in the Spaces of Generalized Functions" potx

Báo cáo hóa học: " Research Article Stability of Cubic Functional Equation in the Spaces of Generalized Functions" potx

Ngày tải lên : 22/06/2014, 18:20
... pp 43 3 4 43 , 2006 [5] P G˘ vruta, A generalization of the Hyers-Ulam-Rassias stability of approximately additive a ¸ mappings,” Journal of Mathematical Analysis and Applications, vol 1 84, no 3, ... Journal of Mathematical Analysis and Applications, vol 251, no 1, pp 2 64 2 84, 2000 [12] Th M Rassias, On the stability of functional equations and a problem of Ulam,” Acta Applicandae Mathematicae, ... Euler-Lagrange quadratic mappings,” Journal of Mathematical Analysis and Applications, vol 220, no 2, pp 6 13 639 , 1998 [11] Th M Rassias, On the stability of functional equations in Banach spaces,”...
  • 13
  • 371
  • 0