composition access and printing of even more elaborate records

Báo cáo khoa học: Protein transport in organelles: The composition, function and regulation of the Tic complex in chloroplast protein import pptx

Báo cáo khoa học: Protein transport in organelles: The composition, function and regulation of the Tic complex in chloroplast protein import pptx

Ngày tải lên : 07/03/2014, 03:20
... plants of the pea ortholog and main Arabidopsis isoform of Tic20, AtTic20-I, similarly exhibit pronounced chloroplast defects, and attic20-I knockouts were albino even in the youngest 1168 parts of ... constituent of the Tic motor complex (see below) The present minireview provides a short description of recent advances in the understanding of the channel-, motor- and regulatory components of the ... Tic40 consists of an N-terminal transmembrane domain and a soluble C-terminus protruding into the stroma Conserved regions of the C-terminus are the TPR domain, consisting of seven predicted...
  • 11
  • 491
  • 0
Bơm ECD-V - P - Composition and Construction of ECD-V3 Pump System

Bơm ECD-V - P - Composition and Construction of ECD-V3 Pump System

Ngày tải lên : 23/10/2012, 09:09
... chamber of the injection pump with the pressure chamber, is a type of solenoid valve that turns ON/OFF (opens and closes) in accordance with the signals from the engine ECU When the coil of the ... 2 Operation of ECD-V3 Pump 2-1 Fuel Suction and Injection The mechanism for the suction and pumping/distribution of the fuel is basically the same as for the ... provide high levels of precision, quick response, and pressure resistance, as well as a large spill volume There are two types of solenoid spill valves: the pilot valve type, and the direct-acting...
  • 4
  • 729
  • 5
Báo cáo khoa học: Fatty acid composition of chylomicron remnant-like particles influences their uptake and induction of lipid accumulation in macrophages pot

Báo cáo khoa học: Fatty acid composition of chylomicron remnant-like particles influences their uptake and induction of lipid accumulation in macrophages pot

Ngày tải lên : 16/03/2014, 12:20
... at 13 h (P < 0.01) and 24 h (P < 0.01) Corn and fish CRLPs were taken up at very similar rates, and there were also no significant differences in the rates of uptake of palm and olive CRLPs Fig ... differential rates of uptake of CRLPs of different fatty acid compositions by macrophages observed in the present study is due to differences in the oxidative state of the particles Evaluation of the lipid ... [39], and it has been Lipid accumulation in macrophages suggested that the lipid composition of lipoproteins can alter the conformation of the protein [40] Thus, the differential uptake of CRLPs of...
  • 9
  • 349
  • 0
Demographic composition and projections of car use in Austria ppt

Demographic composition and projections of car use in Austria ppt

Ngày tải lên : 23/03/2014, 10:20
... according to five compositional variables, or combinations of variables: (1) age of household head, (2) age and sex of household head, (3) size of household, (4) number of adults and children in ... household, and (5) age of household head and size of household For each of these five compositions, we next calculate the mean distance driven by households within each category of the compositional ... However, a composition of households by size is more sensitive to demographic scenarios as compared to a composition of households by age of the household head Projections of transportation demand Our...
  • 45
  • 346
  • 0
Comparison of composition (nutrients and other substances) of organically and conventionally produced foodstuffs: a systematic review of the available literature doc

Comparison of composition (nutrients and other substances) of organically and conventionally produced foodstuffs: a systematic review of the available literature doc

Ngày tải lên : 28/03/2014, 19:20
... Canning No of samples tested, Storage of sample, Age of meat at testing, Cut of meat, Mode of sampling Method of analysis, Which nutrients tested Method of testing, Mode of sampling, Method of analysis, ... Rebarz, K., Influence of irrigation and cultivation system of potatoes on the yields, chemical composition of tubers and uptake of nutrient components Journal of Research and Applications in Agricultural ... identified and included in the review (see Figure 2) Of the included publications, 137 reported on the composition of crops and 25 reported on the composition of livestock products The list of publications...
  • 209
  • 726
  • 0
Methods to access quality and stability of oils and fat  containing foods

Methods to access quality and stability of oils and fat containing foods

Ngày tải lên : 23/05/2014, 12:34
... testing of oils and fat-containing foods Number of Samples The number of samples that can be evaluated in one session is dependent on the nature of the product and on the amount of training and experience ... test” bath, and the analytical balance A set of calibrated weights from the National Bureau of Standards were used, and tenths of milligrams were calculated by the all-butforgotten method of swings ... List, G.R., and Erickson, D.R “Storage, Handling and Stabilization” in Handbook of Soy Oil Processing and Utilization, edited by D.R Erickson, E.H Pryde, O.L Brekke, T.L Mounts, and R.A Falb...
  • 219
  • 1.5K
  • 1
Báo cáo sinh học: " Open Access Cloning of the canine RNA polymerase I promoter and establishment of reverse genetics for influenza A and B in MDCK cells" docx

Báo cáo sinh học: " Open Access Cloning of the canine RNA polymerase I promoter and establishment of reverse genetics for influenza A and B in MDCK cells" docx

Ngày tải lên : 18/06/2014, 18:20
... Background The type A and B influenza viruses have genomes consisting of eight negative-sense single-stranded viral RNAs (vRNAs), each of which contains a coding region and terminal 5' and 3' noncoding ... features of the RNA pol I promoters and rRNA genes from other mammalian species In the genomes of human, mouse and rat, the distance from the beginning of the 18S rRNA sequences to Page of 12 (page ... GGGCAGGTGGCGGTGGGTCTTTTACCCCCGTGCGCTCCATGCCGTGGGCACCCGGCCGTTGGCCGTGACAACCCCTGTCTCGCAAGGCTCCGTGCCGCGTGTCAGGCGTCCCCCGCTGTGTCTGGGGT PrimEx Figure of canis familiaris sequence and sequences of the MDCK EcoRI-BamHI fragment in pK9Pol I EB Alignment Alignment of canis familiaris sequence and sequences of the MDCK EcoRI-BamHI...
  • 12
  • 567
  • 0
báo cáo hóa học: " Funding free and universal access to Journal of Neuroinflammation" doc

báo cáo hóa học: " Funding free and universal access to Journal of Neuroinflammation" doc

Ngày tải lên : 19/06/2014, 22:20
... University of Potsdam [4] in Germany, at INIST [5] in France and in e-Depot [6], the National Library of the Netherlands' digital archive of all electronic publications Benefits of Open Access publishing ... a high profile that should raise awareness of Open Access publishing in general This, in turn, should encourage researchers in all disciplines to understand and accept Open Access, and to accept ... 1:19 nal of Neuroinflammation provides free, publication-quality pdf files for distribution, in lieu of reprints Free access versus Open Access Several traditional journals now offer free access...
  • 3
  • 286
  • 0
báo cáo hóa học:" A biregional survey and review of first-line treatment failure and second-line paediatric antiretroviral access and use in Asia and southern Africa" pot

báo cáo hóa học:" A biregional survey and review of first-line treatment failure and second-line paediatric antiretroviral access and use in Asia and southern Africa" pot

Ngày tải lên : 20/06/2014, 08:20
... using the cutoff of more than 1000 copies/ml reported a cumulative probability of failure by three years after ART initiation of 19.3% [13], and a study of children and adolescents in Uganda reported ... Bangkok, Thailand School of Public Health and Family Medicine, University of Cape Town, Cape Town, South Africa 3Institute of Social and Preventive Medicine, University of Bern, Bern, Switzerland Authors’ ... Graber and Olivia Keiser, Institute of Social and Preventive Medicine, University of Bern, Bern, Switzerland; Andrew Boulle, Morna Cornell, Mary-Ann Davies, Nicola Maxwell, Landon Myer and Anna...
  • 8
  • 364
  • 0
báo cáo hóa học:" Imprisoned and imperiled: access to HIV and TB prevention and treatment, and denial of human rights, in Zambian prisons" ppt

báo cáo hóa học:" Imprisoned and imperiled: access to HIV and TB prevention and treatment, and denial of human rights, in Zambian prisons" ppt

Ngày tải lên : 20/06/2014, 08:20
... way of systematically presenting key indicators, as well as of allowing more thorough documentation of conditions and nuanced understanding of the interrelation of key variables Prisoner and ... prisoners and prison officers in six prisons, and interviews with government and NGO key informants We also reviewed Zambian laws and policies and international human rights laws and standards ... swift spread of disease both into and out of prison settings Recognition of the importance of protecting human rights in addressing HIV and TB vulnerability is often Todrys et al Journal of the International...
  • 11
  • 464
  • 0
báo cáo hóa học:" A biregional survey and review of first-line treatment failure and second-line pediatric antiretroviral access and use in Asia and southern Africa" pdf

báo cáo hóa học:" A biregional survey and review of first-line treatment failure and second-line pediatric antiretroviral access and use in Asia and southern Africa" pdf

Ngày tải lên : 20/06/2014, 08:20
... 2011, 14:17 http://www.jiasociety.org/content/14/1/17 Page of Switzerland and the School of Public Health and Family Medicine, University of Cape Town, Cape Town, South Africa Received: 28 March ... paediatric antiretroviral access and use in Asia and southern Africa J Int AIDS Soc 2011, 14(1):7 doi:10.1186/1758-2652-14-17 Cite this article as: and : A biregional survey and review of first-line treatment ... failure and second-line pediatric antiretroviral access and use in Asia and southern Africa Journal of the International AIDS Society 2011 14:17 Submit your next manuscript to BioMed Central and...
  • 3
  • 343
  • 0
Health and Quality of Life Outcomes BioMed Central Editorial Open Access Not-only-a-title Clare pptx

Health and Quality of Life Outcomes BioMed Central Editorial Open Access Not-only-a-title Clare pptx

Ngày tải lên : 20/06/2014, 15:20
... "Health-related quality of life outcomes" and Health and quality of life" are closer to the journal's intent James W Varni, Ph.D Professor of Psychiatry, University of California, San Diego School of Medicine ... a matter of fact this has been implicit in our work The title "Health and Quality of Life Outcomes" encompasses all these and much more and befits our intentions and the holism much more comprehensively ... Dpt of Psychiatry and Behavioral Sciences Standford University Medical Center, USA I would lean toward Health and Quality of Life Outcomes Robert M Kaplan, Ph.D Professor and Chair Page of 10...
  • 10
  • 330
  • 0
Health and Quality of Life Outcomes BioMed Central Research Open Access Changes in health-related doc

Health and Quality of Life Outcomes BioMed Central Research Open Access Changes in health-related doc

Ngày tải lên : 20/06/2014, 15:20
... Mean values for age and SAPS II and median values for *LOS and **IPPV days (hours/24) Comparison of medical and surgical ICU patients, and of ICU patients with increasing and patients with decreasing ... Heyland DK, Hopman W, Coo H, Tranmer J and McColl MA Longterm health-related quality of life in survivors of sepsis Short Form 36: a valid and reliable measure of health-related quality of life ... (after years) and that simultaneous longitudinal changes in HRQOL can be a measure of effectiveness of rehabilitation and rate of recovery [19] Few such studies have been performed The aim of this...
  • 9
  • 345
  • 0
Health and Quality of Life Outcomes BioMed Central Commentary Open Access Clinical and Outcome docx

Health and Quality of Life Outcomes BioMed Central Commentary Open Access Clinical and Outcome docx

Ngày tải lên : 20/06/2014, 15:20
... goals of improved exercise tolerance and emotional function (health-related quality of life) and also important clinical goals such as prevention of disease progression and minimization of symptoms ... patients, and often correlate poorly with the clinical status of the airways (e.g airway inflammation and obstruction) [10] More recently, the GOLD guidelines have identified the goals of treatment ... Health and Quality of Life Outcomes 2003, Introduction Chronic obstructive pulmonary disease (COPD) is one of the leading causes of morbidity and mortality in industrialized and developing...
  • 6
  • 570
  • 0
Health and Quality of Life Outcomes BioMed Central Research Open Access What is the relationship docx

Health and Quality of Life Outcomes BioMed Central Research Open Access What is the relationship docx

Ngày tải lên : 20/06/2014, 15:20
... terms of the underlying distribution of the results Investigators may express effects in terms of between-person standard deviation units, within-person standard deviation units, and the standard ... raw score change on measure; SE = standard error of the difference; SD = standard deviation at time 1; SD* = standard deviation of D; SD# = standard deviation of D among stable subjects (those ... to estimate the weighted grand mean of the MID and to test the hypothesis of homogeneity of MID across the nine studies If there was no statistical evidence of lack of homogeneity, a 95% confidence...
  • 8
  • 484
  • 0
Health and Quality of Life Outcomes BioMed Central Research Open Access Using multiple survey docx

Health and Quality of Life Outcomes BioMed Central Research Open Access Using multiple survey docx

Ngày tải lên : 20/06/2014, 15:20
... systems, CATI systems, and the printing and mailing of survey instruments and related materials; maximizing response rates – sets minimum expectations on the number and type of resources to be utilized ... monitoring of data entry by vendor staff, and preparation and submission of data files; beneficiary confidentiality – mandates specific requirements for confidentiality of person-level data; and, http://www.hqlo.com/content/1/1/6 ... Electronic Data Files Sent to CDAC Comparison of Vendor Electronic Files and Gold Standard CMS Selects Sample Comparison of Vendor Electronic Files and CDAC Standard Vendors Submit Hard Copies Data...
  • 6
  • 314
  • 0
Health and Quality of Life Outcomes BioMed Central Research Open Access Do English and Chinese doc

Health and Quality of Life Outcomes BioMed Central Research Open Access Do English and Chinese doc

Ngày tải lên : 20/06/2014, 15:20
... Page of (page number not for citation purposes) Health and Quality of Life Outcomes 2003, Authors' contributions NL and JT designed and supervised the study, analyzed and interpreted data, and ... 1985, 70:662680 Anderson RT, Aaronson NK, Leplege AP and Wilkin D International use and application of generic health-related quality of life instruments In: Quality of life and Pharmacoeconomics ... Quality of Life Assessment Project (IQOLA) [34] and the European Organisation for Research and Treatment of Cancer (EORTC) Quality of Life Study Group [35] In addition to conceptual and psychometric...
  • 7
  • 347
  • 0
Health and Quality of Life Outcomes BioMed Central Review Open Access Benefits of psychosocial pdf

Health and Quality of Life Outcomes BioMed Central Review Open Access Benefits of psychosocial pdf

Ngày tải lên : 20/06/2014, 15:20
... Canadian Association of Psychosocial Oncology has published a book of Standards which details principles of practice, professional issues, and organization and structure of psychosocial oncology ... distress and improve quality of life in cancer patients are widely available, highly effective, and standardized Given the bulk of literature available detailing the efficacy of various types of interventions ... types of cancer [49,50], and standardized group psychoeducation for patients with any kind of cancer diagnoses [51–53] Page of (page number not for citation purposes) Health and Quality of Life...
  • 9
  • 298
  • 0
Health and Quality of Life Outcomes BioMed Central Research Open Access Dyspnea and quality of pdf

Health and Quality of Life Outcomes BioMed Central Research Open Access Dyspnea and quality of pdf

Ngày tải lên : 20/06/2014, 15:20
... Well-being; Functional Wellbeing; and Social and Spiritual Well-being.[16] Total scores may range from a low of zero to a high of 280 Evidence of validity and reliability of the HQLI was generated by ... routine of daily life is altered and both patients and family members must struggle to adjust and respond to new demands.[9] Recent research suggests that family caregivers experience depression and ... and Quality of Life Outcomes 2003, been used by Moody, et al in a number of dyspnea and quality of life studies.[4,5] Reliability of the scale has ranged from 88 to 94 Content validity and concurrent...
  • 8
  • 374
  • 0
Health and Quality of Life Outcomes BioMed Central Research Open Access Impact of stress docx

Health and Quality of Life Outcomes BioMed Central Research Open Access Impact of stress docx

Ngày tải lên : 20/06/2014, 15:20
... GA and Worden TJ The experience and expression of anger: Construction and validation of an anger expression scale In: Anger Page of (page number not for citation purposes) Health and Quality of ... findings, with incorporation of a randomized controlled study design and use of documented records of behavior rather than typical self-report data which are open to the problem of social desirability ... steps are conducted individually and consist of a personal interview, and instruction The remaining three steps are verification and validation of the practice and are presented in a group format...
  • 7
  • 391
  • 0