complexity quantitative traits and plant breeding a role for simulation modelling in the genetic improvement of crops
Báo cáo y học: "Genomic neighborhoods for Arabidopsis retrotransposons: a role for targeted integration in the distribution of the Metaviridae" docx
... element abundance in A thaliana Wright et al [33] examined recombination rate relative to element abundance in detail and found that the abundance of most A thaliana TE families actually had a small ... RetroMap-generated datafile was used as the data source for statistical testing The data file contains chromosomal element coordinates, LTR identity, age and lineage information for all A thaliana ... tested The Athila elements are large, and our underestimate of the number of Athila elements resulted in a corresponding underestimate of the total amount of retrotransposon DNA in the A thaliana...
- 16
- 304
- 0
Báo cáo khoa học: A role for serglycin proteoglycan in granular retention and processing of mast cell secretory granule components ppt
... the dramatic effects of the SG knockout on granular staining properties and storage of proteases, it was first important to determine whether the lack of SG affected the actual assembly of granules ... b-hexosaminidase is in uenced by SG Although b-hexosaminidase activity was already detected at day 0, the intracellular content of this enzyme increased markedly after days of culture, and reached a ... a plateau of maximal storage seen after 26 days of culture mMCP-6 storage showed similar kinetics as for mMCP-5 In contrast, CPA protein was detected as early as after days of culture, and a...
- 12
- 438
- 0
Báo cáo y học: "Elevated extracellular matrix production and degradation upon bone morphogenetic protein-2 (BMP-2) stimulation point toward a role for BMP-2 in cartilage repair and remodeling" pps
... patellar and tibial cartilage was assessed The cartilage of the patella and the tibia was isolated 3, 7, and 21 days after viral injection and incubated with 35SO42- for hours The proteoglycan synthesis ... visual investigation Therefore, the safranin O staining intensity was scored in patellar and tibial cartilage with a computerized imaging system There was a significant (30%) increase in safranin ... staining intensity in the patella on day When the data of all time points were pooled, a significant increase in safranin O staining was observed The tibial cartilage, however, did not display...
- 11
- 401
- 0
báo cáo khoa học: " Bridging the gap between basic science and clinical practice: a role for community clinicians" pptx
... and other information that would help them gauge the quantitative and qualitative value of their participation in studies A clinical trial registry would also provide a venue for sharing trial ... communities Clinicians working with their patients can facilitate meaningful quality assurance practices related to patient inclusion and exclusion, to data gathering, and to a nuanced awareness of the ... Explanatory and practical clinical trials: Two options for clinical trials in community settings [7,42] Explanatory clinical trials: Practical clinical trials: Hypothesis and design Hypothesis and...
- 11
- 460
- 0
Báo cáo lâm nghiệp: "Roles of European and Japanese larch in the genetic control of growth, architecture and wood quality traits in interspecific hybrids (Larix × eurolepis Henry)" pot
... (SHA/GHA) are given in Table VI for the main variables at the oldest ages available With one exception, standard errors are all lower than their parameter estimates and for the majority of them, they ... significant differences except among females for branch angle in factorial and among males in factorial for branch density (Tab IV) For both traits in factorial and for branch angle only in factorial ... respectively for female and male components in factorial and 2.7% compared to 1.3 and 7.7% respectively for female and male components in factorial For branching, both Japanese and European larch clones...
- 9
- 380
- 0
Báo cáo y học: "A model of inflammatory arthritis highlights a role for oncostatin M in pro-inflammatory cytokine-induced bone destruction via RANK/RANK" pps
... staining for RANKL in synovial cells and in the infiltrating (inflammatory) cells (Fig 4h) There was a marked increase in RANKL expression, consistent with the increase in inflammatory cells and ... corresponding to amino acids 317–616 mapping at the carboxy terminus of RANK of human origin [H-300]) or against RANKL (rabbit polyclonal antibody raised against the epitope corresponding to amino acids ... RANK/ RANKL in inflammatory cells, in inflamed synovium, in articular cartilage and at the invading front of bone erosions It has been long recognized that pro-inflammatory cytokines are intimately...
- 8
- 380
- 0
Báo cáo y học: " Effects of inhaled iloprost on right ventricular contractility, right ventriculo-vascular coupling and ventricular interdependence: a randomized placebo-controlled trial in an experimental model of acute pulmonary hypertension" ppt
... central venous catheter was inserted into the femoral vein A 16-G arterial catheter was advanced into the descending aorta via the femoral artery A lateral cut-down was performed in the cervical ... performance and cardiac loading conditions in an experimental model for acute PHT as well as in healthy animals with intact and pharmacologically blocked ANS Materials and methods This investigation ... for the final study design, participated in the animal experiments, supported the data acquisition and the statistical analysis, and edited the final manuscript All authors read and approved the...
- 13
- 231
- 0
Báo cáo y học: "A role for prophylactic antibiotics in necrotizing pancreatitis" doc
... superinfection, and therefore may affect the risk for pancreatic infection Time for a change For all of the above reasons, the beneficial effect of prophylactic antibiotics in the ideal standardized setting ... patient truly at risk for infection and have a treatment modality that has no relevant side effects and that can be initiated in a timely fashion, the role of antibiotics in patients with established ... performed Timely initiation of antibiotics is essential in pancreatic infection, just as in any other (intra-abdominal) infection Therefore, a low threshold for an aggressive diagnostic approach...
- 2
- 284
- 0
báo cáo hóa học:" Usefulness of five-item and three-item Mental Health Inventories to screen for depressive symptoms in the general population of Japan" ppt
... Japanese [8], and the Japanese version has been validated for use in the general population of Japan [9], but the performance of the MHI-5 has not been evaluated in detail In addition, two of the ... performance of the MHI-5 and the MHI-3 The AUC values are shown in Table 3, and other performance characteristics are shown in Table We also evaluated the performance of each of the MHI-5 question ... Setting and participants We used data that had been collected previously for a study of the validity of the Japanese version of the SF-36, and calculated national norm scores of all subscales of...
- 7
- 547
- 0
Báo cáo hóa học: "A framework for ABFT techniques in the design of fault-tolerant computing systems" pot
... syndromes and comparing against thresholds five times the standard deviation of syndrome values when only low levels of round-off error appear The simulation program randomly selects the line in a magnitude ... samples Burst and errors within each block are permitted A burst in this context means that the standard deviations of all components in a block are raised to 10% of the maximum standard deviation ... blocks of data over a wide range of variances are performed For the Figure Detection performance of the comparator versus threshold Hamidi et al EURASIP Journal on Advances in Signal Processing...
- 12
- 574
- 0
Báo cáo lâm nghiệp: "Across-site heterogeneity of genetic and environmental variances in the genetic evaluation of Eucalyptus globulus trials for height growth" ppt
... respective sampling variances, obtained from the inverse of the average information matrix Using the estimated components of variance, approximations of additive genetic, dominance, epistatic and environˆ ... obtained by the square root of the respective sampling variances, and these were calculated from the sampling (co)variances of the components in the denominator of equation (3) ˆ The standard ... considering that the trials are all measured at the i same age, assuming no G × E interaction and that no site is more representative of the plantation zone than any other For complete and balanced...
- 9
- 392
- 0
Báo cáo khoa học: "Is there a place for N-acetylcysteine in the treatment of septic shock" pptx
... microcirculation and thus oxygen extraction, while at the same time attenuating inflammatory responses Prostacyclin, a prostaglandin synthesized in endothelial cells, is a potent vasodilator and an inhibitor ... groups The number of days of acute lung injury was decreased, however, and there was also a significant increase in the cardiac index in the NAC-treated group [20] Conclusions This is an exciting ... the sample size was small in the extended case report [1], Hein and colleagues have made a significant contribution to our understanding of the important role of antioxidant agents such as NAC...
- 3
- 469
- 0
Effective management for acidic pollution in the canal network of the Mekong Delta of Vietnam: A modeling approach
... is capable of simulating the temporal and spatial variations of water pH (as an indicator of acidity), salinity and water flow in a coastal canal networks It was calibrated with the 2003-data and ... shows the advantages of considering land use and water salinity control before analyzing acidity generation and propagation for water quality management in a coastal area overlain with ASS The ... management, land uses of ASS and acidic pollution have led to a 70% reduction in income of the farmers living in the ASS area of Ca Mau peninsula, a coastal area of the Mekong Delta of Vietnam On ASS,...
- 12
- 483
- 0
báo cáo khoa học: " Construction of a potato consensus map and QTL meta-analysis offer new insights into the genetic architecture of late blight resistance and plant maturity traits" pps
... distances between adjacent markers from all individual maps rescaled in Haldane unit The size and type of the mapping population are used to estimate the map accuracy and are integrated into the ... provide interesting targets for candidate gene approach and for marker-assisted breeding [66] Meta-analysis could also be useful for comparative QTL mapping across widely related crops of Page 12 of ... as described in the original publication when available (interval length of a certain LOD decrease) Otherwise, the confidence interval estimate was calculated with the empirical formula of Darvasi...
- 17
- 593
- 0
Tài liệu Báo cáo khoa học: Mitochondrial targeting of intact CYP2B1 and CYP2E1 and N-terminal truncated CYP1A1 proteins in Saccharomyces cerevisiae ) role of protein kinase A in the mitochondrial targeting of CYP2E1 pdf
... Bhagwat SV, Biswas G, Anandatheerthavarada HK, Addya S, Pandak W & Avadhani NG (1999) Dual targeting property of the N-terminal signal sequence of P450 1A1 Targeting of heterologous proteins to ... in endogenous signalling pathways and environmental carcinogenesis Nat Rev Cancer 6, 947–960 Addya S, Anandatheerthavarada HK, Biswas G, Bhagwat SV, Mullick J & Avadhani NG (1997) Targeting of ... were initiated by the addition of mm NADPH, and incubation was continued for 30 at 37 °C in a shaking water bath The reactions were terminated by adding mL of ice-cold methanol, and insoluble particles...
- 16
- 650
- 0
Báo cáo khóa học: Mutational and computational analysis of the role of conserved residues in the active site of a family 18 chitinase docx
... constant of eight was used for the protein [39] A significant speed-up of the calculations was achieved by calculating pKa values for only a subset of the titratable groups in the protein The subset ... substrate-binding, Asp142 moves into the ÔupÕ position and interacts with the substrate and Glu144 This rotation of Asp142 is accompanied by removal of a water molecule and adjustments of Tyr10 and ... [26,29] The pKa calculations indicate that Glu144 has a slightly elevated pKa in the free enzyme that, at least in part, results from the vicinity of Asp215 (Table 3, rows and 4) The calculations indicate...
- 10
- 651
- 0
Báo cáo Y học: A polymer with a backbone of 3-deoxy-D-glycero -D-galacto -non-2ulopyranosonic acid, a teichuronic acid, and a b-glucosylated ribitol teichoic acid in the cell wall of plant pathogenic Streptomyces sp. VKM Ac-2124 pdf
... essential for their growth taxis and their attachment to potato tuber The presence of Kdn might be characteristic of plant pathogenic streptomycete strains causing scab diseases of potatoes and ... ester obtained upon alkaline hydrolysis of glucosylated ribitol teichoic acid from the cell wall of S azureus RIA 1009 [24] and based on the analysis of the products formed upon acid and enzymatic ... fi6 )a- D-Glcp-(1fi4)-b-D-ManpNAc3NAcA-(1fi was the major component of the cell wall preparation The absolute configuration of glucose (D-) isolated after hydrolysis of the total cell wall preparation was determined...
- 6
- 561
- 0
central banking, asset prices, and financial fragility what role for a central bank
... Reproduced with permission of the copyright owner Further reproduction prohibited without permission Reproduced with permission of the copyright owner Further reproduction prohibited without ... permission Reproduced with permission of the copyright owner Further reproduction prohibited without permission Reproduced with permission of the copyright owner Further reproduction prohibited without ... permission Reproduced with permission of the copyright owner Further reproduction prohibited without permission Reproduced with permission of the copyright owner Further reproduction prohibited without...
- 469
- 228
- 0
Báo cáo y học: " Tumour necrosis factor-α stimulates dehydroepiandrosterone metabolism in human fibroblast-like synoviocytes: a role for nuclear factor-κB and activator protein-1 in the regulation of expression of cytochrome p450 enzyme 7b" doc
... protocol using random hexamer primers (Pharmacia, Woerden, The Netherlands) and reverse transcriptase (Pharmacia) For reverse transcription PCR, human Cyp7b sense (GTCCTGGAGAAATATTATGTGCAG) and antisense ... studies, carried out most of the assays and wrote the manuscript AK (Allard Kaptein) helped in conceiving the study and helped to draft the manuscript AK (Annemieke Kavelaars) and CH were involved in ... as the percentage [3H]-7α-OH-DHEA of the total amount of [3H]-label measured Results are expressed as the mean ± standard error of the mean of triplicate samples The data are representative of...
- 10
- 462
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25