comparison of neural differentiation potential of human pluripotent stem cell lines using a quantitative neural differentiation protocol
Atlas of Human Pluripotent Stem Cells doc
Ngày tải lên :
22/03/2014, 09:20
... Atlas of Human Pluripotent Stem Cells Derivation and Culturing With contributions by Ilana Laevsky, BA and Atara Novak, MSc Michal Amit, PhD Department of Obstetrics and Gynecology Rambam Health ... teratocarcinoma stem cells Proc Natl Acad Sci U S A 78(12):7634–7638 Steptoe PC, Edwards RG (1978) Birth after the reimplantation of a human embryo Lancet 2(8085):366 Takahashi K, Yamanaka S ... derivation of human lines using basically the same culturing techniques M Amit and J Itskovitz-Eldor, Atlas of Human Pluripotent Stem Cells: Derivation and Culturing, Stem Cell Biology and Regenerative...
- 157
- 579
- 0
Overexpression of hTERT increases stem-like properties and decreases spontaneous differentiation in human mesenchymal stem cell lines ppt
Ngày tải lên :
10/08/2014, 05:21
... Traumatology, Veterans General Hospital, Taipei, Taiwan Graduate Institute of Dental Sciences and Department of Periodontology, National Taiwan University, Taipei, Taiwan 3Graduate Institute of ... http://www.partek.com) All microarray datasets in this paper are available at GEO under the accession no of GSE7234 and GSE9520 Results Downregulation of Oct4 and Nanog and upregulation of developmental ... calculated using a t-test Additional file 4: Real-time RT-PCR analysis of expression levels of (A) DNMT1, DNMT 3A and DNMT3B, and (B) EZH2 in 3A6 and KP Additional file 5: (A) RT-PCR analysis of...
- 13
- 279
- 0
Báo cáo y học: " GeneChip analysis of human embryonic stem cell differentiation into hemangioblasts: an in silico dissection of mixed phenotypes" docx
Ngày tải lên :
14/08/2014, 08:20
... Antisense 5'-GAAGGTATTCAGCCAAACGAC-3' 5'-GTTACAGAACCACACTCGGA-3' 55 315 Nanog Sense Antisense 5'-TGCAAATGTCTTCTGCTGAGAT-3' 5'-GTTCAGGATGTTGGAGAGTTC-3' 55 285 Rex-1 Sense Antisense 5'-TGACAGGCAAGAAGCTTCCG-3' ... EB and BC data sets associated with GATA2 Ingenuity pathway analysis of a network of genes expressed in EB and BC data sets associated with GATA2 In the EB data set, the GATA2 network contained ... metabolism, acute myocardial infarction, hematopoietic cell lineage pathways and calcium signaling pathways GenMapp was then used for pathway analysis Each genetic signature was assigned a color:...
- 19
- 359
- 0
Báo cáo y học: "A comparative analysis of DNA methylation across human embryonic stem cell lines" docx
Ngày tải lên :
09/08/2014, 23:20
... Bioinformatics 2009, 25:167-174 Yoshida-Hata N, Mitamura Y, Oshitari T, Namekata K, Harada C, Harada T, Yamamoto S: Transcription factor, SP1, in epiretinal membranes of patients with proliferative ... To be called a SNP, a locus had to have a coverage of at least eight reads, and a ratio between 0.5 and 0.6 for the major allele For each gene we calculated the probability that the major and minor ... Establishing, maintaining and modifying DNA methylation patterns in plants and animals Nat Rev Genet 2010, 11:204-220 Athanasiadou R, de Sousa D, Myant K, Merusi C, Stancheva I, Bird A: Targeting of de...
- 12
- 458
- 0
Báo cáo y học: "Susceptibilities of medaka (Oryzias latipes) cell lines to a betanodavirus" docx
Ngày tải lên :
12/08/2014, 04:20
... interference antagonist that facilitates intracellular viral RNA accumulation J Virol 2006, 80:85-94 Iwamoto T, Mise K, Takeda A, Okinaka Y, Mori K, Arimoto M, Okuno T, Nakai T: Characterization of Striped ... merged image of Alexa488-fluorescence and DAPI staining (B) Rates for the infected cells against the total cells represented in Figures and 3A were calculated and shown periodically Adachi et al Virology ... OLCABe31 and OLME-104 cells virus can multiply in all of the cell lines to a varying degree Virus spread To examine whether RGNNV spread occur in the medaka cell lines which lacked clear appearance of...
- 7
- 199
- 0
Human pluripotent stem cell derived cellular vehicles for cancer gene therapy
Ngày tải lên :
09/09/2015, 10:08
... viral and non viral vectors (Samaranayake et al., 2010) Angiostatin, a plasmin degradation product, binds to and inhibits the proliferation and migration of endothelial cells (Samaranayake et al., ... potential of using naked DNA for cancer gene therapy However, free DNA is rapidly degraded and has low cellular uptake (Touchefeu et al., 2010) As a result, major applications of naked DNA are vaccination ... animal models to successfully erase liver metastases (Caruso et al., 1993), hepatocellular carcinomas (Kuriyama et al., 1999), head and neck carcinomas (O’Malley, 1995), and glioblastomas (Takamiya...
- 158
- 188
- 0
Roles of long non coding RNAs in human embryonic stem cell pluripotency and neural differentiation 1
Ngày tải lên :
09/09/2015, 17:54
... R: ggagccgtagtgagcagttc atgcctcacacggagactgt aagtgggttgtttgcctttg ggcacagttagagccaactaaga ccgagcagcactaacacg gagaggcagctgagatcagaa tgagaatacgatgtctgcaggt gtggagagcaactccgatg tctgcagagctttgatgtcc ... ggcacacacacattaacacactt ggtgtgtgagagcaattctcag aggtggttgaccttcaatgg tttgatttcttccagcattgtg gagtctgcctgttgcagga cagcgtctgacagcgaca aagttcaacaacaactgctaccaa gaagctcgtcatgcagttca ttgctgcctctttaagactagga ... agaaggagctgcgacaattc tccaaagtaggtgaccaagtcc gaccccaaggattacctcatt gttgatggcctccagtgac gcacacgttattcggatcg gcttgtcctccttctcgttc aactacgcgtttctccatgc aaagtgggcctttctccatc agccacatcgctcagacac gcccaatacgaccaaatcc...
- 83
- 381
- 0
Roles of long non coding RNAs in human embryonic stem cell pluripotency and neural differentiation 3
Ngày tải lên :
09/09/2015, 17:54
... indicates that loss of the neuronal lncRNAs altered cellular differentiation fate from a neurogenic to a gliogenic program, and suggests that the lncRNAs play a key role in neural cell fate specification ... 7.2: RNA-seq analysis indicating transcription start and end sites of neuronal lncRNAs (A) The three isoforms of RMST are namely AK056164, AF429305 and AF429306 (B) lncRNA_N1 (AK124684) is a single-exon ... transfection of siRNAs Neural stem cells were plated one day prior to siRNA transfection Neuronal differentiation was induced in N2B27 medium Transfection of siRNAs was performed again at day 3, for...
- 55
- 327
- 0
Roles of long non coding RNAs in human embryonic stem cell pluripotency and neural differentiation 4
Ngày tải lên :
09/09/2015, 17:54
... colocalization of the RMST signal and the DAPI stain confirmed that RMST is a nuclear-localized lncRNA (Figure 8.11B) Figure 8.11: RMST is a nuclear-localized lncRNA (A) Cellular RNA was separated ... nuclear and cytoplasmic fractions by RNA fractionation, and abundance of the RNA transcripts in either fraction was assayed by qPCR The nuclear/cytoplasmic ratio was computed presented in the graph ... detected in both thr roof plate (RP) and the floor plate (FP), as well as in the outermost layer of cells in the alar plate (ALP) and intermediate zone of the basal plate (BP) (C-F) Rmst expression...
- 13
- 275
- 0
Roles of long non coding RNAs in human embryonic stem cell pluripotency and neural differentiation 5
Ngày tải lên :
09/09/2015, 17:55
... (hESCs), and human neuronal development, using hESCs as a cellular model for neural differentiation 9.1.1 Identification of functional human lncRNAs Using a microarray approach, lncRNAs highly expressed ... 71-82 Takahashi, K., Tanabe, K., Ohnuki, M., Narita, M., Ichisaka, T., Tomoda, K., and Yamanaka, S (2007) Induction of pluripotent stem cells from adult human fibroblasts by defined factors Cell ... 1484-1488 Katayama, S., Tomaru, Y., Kasukawa, T., Waki, K., Nakanishi, M., Nakamura, M., Nishida, H., Yap, C.C., Suzuki, M., Kawai, J., et al (2005) Antisense transcription in the mammalian transcriptome...
- 34
- 316
- 0
Báo cáo khoa học: Comparison of human RNase 3 and RNase 7 bactericidal action at the Gram-negative and Gram-positive bacterial cell wall pot
Ngày tải lên :
22/03/2014, 21:20
... have shown that RNase and RNase have particular antimicrobial activities that are modulated by their action at the bacterial cell wall We observed that RNase displays a mechanism based on local ... RNase and RNase bactericidal activity M Torrent et al was continuously measured using a Cary Eclipse Spectrofluorimeter (Varian Inc., Palo Alto, CA, USA) RNase A was used in all cases as a negative ... collected at several magnifications A total of ten micrographs were collected at random for each condition, and the number of isolated cells and aggregates was registered RNase and RNase bactericidal activity...
- 13
- 465
- 0
báo cáo hóa học:" MicroRNA and gene expression patterns in the differentiation of human embryonic stem cells" doc
Ngày tải lên :
18/06/2014, 15:20
... CanonicalCorrelation Analysis Journal of Statistical Software 2008, 23(12):1-14 Takakura S, Mitsutake N, Nakashima M, Namba H, Saenko VA, Rogounovitch TI, Nakazawa Y, Hayashi T, Ohtsuru A, Yamashita ... 26(2):356-363 Takamizawa J, Konishi H, Yanagisawa K, Tomida S, Osada H, Endoh H, Harano T, Yatabe Y, Nagino M, Nimura Y, et al.: Reduced expression of the let-7 microRNAs in human lung cancers in association ... LG, Luttun A, Crabbe A, Geraerts M, Sharov AA, Piao Y, Ko MS, et al.: Comparative transcriptome analysis of embryonic and adult stem cells with extended and limited differentiation capacity Genome...
- 17
- 593
- 0
Báo cáo y học: "Chordin knockdown enhances the osteogenic differentiation of human mesenchymal stem cells" pdf
Ngày tải lên :
09/08/2014, 10:23
... activity and incorporation of calcium in the extracellular matrix The deposition of a mineralized matrix was further examined by staining with Alizarin Red Alkaline phosphatase assay ALP activity was ... osteogenic differentiation studies Media of all cultures was changed every days Measurement of alkaline phosphatase activity and in vitro mineralisation Osteogenic differentiation of human MSCs was evaluated ... the extracellular matrix was quantified using the commercial diagnostic kit QuantiChrom Calcium Assay Kit (DICA-500; Bio Assay Systems, Hayward, CA, USA), in accordance with the manufacturer's...
- 9
- 404
- 0
Báo cáo y học: "Hypertrophy is induced during the in vitro chondrogenic differentiation of human mesenchymal stem cells by bone morphogenetic protein-2 and bone morphogenetic protein-4 gene transfer" pps
Ngày tải lên :
09/08/2014, 14:22
... CCCTTTTTGCTGCTAGTATCC Antisense: CTGTTGTCCAGGTTTTCCTGGCAC 54 468 25 OP Sense: ACGCCGACCAAGGAAAACTC Antisense: GTCCATAAACCACACTATCACCTCG 51 483 35 ALP (rt) Sense: TGGAGCTTCAGAAGCTCAACACCA Antisense: ATCTCGTTGTCTGAGTACCAGTCC ... ATCTCGTTGTCTGAGTACCAGTCC 51 454 IHH Sense: GAGGAGTCCCTGCATTATGA Antisense: CAGGAAAATGAGCACATCGC 54 321 30 RUNX2 Sense: ACAGATGATGACACTGCCACC Antisense: CATAGTAGAGATATGGAGTGCTGC 55 324 35 54 234 25 Internal ... markers COL II Sense: TTTCCCAGGTCAAGATGGTC Antisense: CTTCAGCACCTGTC CACCA 58 374 35 AGC Sense: TGAGGAGGGCTGGAACAAGTACC Antisense: GGAGGTGGTAATTGCAGGGAACA 54 392 30 COMP Sense: CAGGACGACTTTGATGCAGA...
- 15
- 830
- 0
Fibronectin and laminin promote differentiation of human mesenchymal stem cells into insulin producing cells through activating Akt and ERK pptx
Ngày tải lên :
10/08/2014, 05:21
... interpretation, and manuscript writing All authors read and approved the final manuscript Author details Stem Cell Laboratory, Department of Medical Research and Education, Veterans General Hospital-Taipei, ... and CCT assisted with conception and design, collection and assembly of data, data analysis and interpretation, and manuscript writing, LLC assisted with collection and assembly of data, data ... differentiation of fetal mouse pancreatic beta-cells Diabetes 1999, 48(4):722-730 Edamura K, Nasu K, Iwami Y, Ogawa H, Sasaki N, Ohgawara H: Effect of adhesion or collagen molecules on cell attachment,...
- 10
- 332
- 0
báo cáo khoa học: "Epigenomics of human embryonic stem cells and induced pluripotent stem cells: insights into pluripotency and implications for disease" potx
Ngày tải lên :
11/08/2014, 12:21
... L, van Steensel B: Molecular maps of the reorganization of genome-nuclear lamina interactions during differentiation Mol Cell 2010, 38:603-613 83 Takahashi K, Okita K, Nakagawa M, Yamanaka S: ... GB, Page 13 of 13 Fink AA, Weder AB, Cooper RS, Galan P, Chakravarti A, Schlessinger D, Cao A, Lakatta E, Abecasis GR: Genome-wide association scan shows genetic variants in the FTO gene are associated ... of pluripotent stem cells from fibroblast cultures Nat Protoc 2007, 2:3081-3089 84 Takahashi K, Tanabe K, Ohnuki M, Narita M, Ichisaka T, Tomoda K, Yamanaka S: Induction of pluripotent stem cells...
- 13
- 338
- 0
Engineered poly(l lactic acid) based nanofibers for osteogenic differentiation of human mesenchymal stem cells
Ngày tải lên :
09/09/2015, 10:07
... Liao, Casey K Chan and Seeram Ramakrishna Stem Cell Response to Biomaterial Topography In: Murugan Ramalingam, Seeram Ramakrishna and Serena Best, editors Biomaterials and Stem Cells in Regenerative ... between passage and passage The proliferation of the cells at passage and passage were significantly higher than passage and passage Comparing two groups of PLLA and TCPS, the cell proliferation ... Nguyen, Yan Su, Wee Eong Teo, Susan Liao, Seeram Ramakrishna and Ching Wan Chan Cell viability and angiogenic potential of a bioartificial adipose graft Journal of Tissue Engineering and Regenerative...
- 272
- 258
- 0
Applying macromolecular crowding to promote the expansion and adipogenic differentiation of human mesenchymal stem cells in vitro; an effect of matrix reciprocity
Ngày tải lên :
11/09/2015, 09:16
... Tierney A, et al 1997;Differential binding of fibroblast growth factor-2 and -7 to basement membrane heparan sulfate: comparison of normal and abnormal human tissues Am J Pathol (4):1443-1455 67 Yayon ... Chuan P, et al 2009;Heparan sulfate mediates the proliferation and differentiation of rat mesenchymal stem cells Stem Cells Dev (4):661-670 69 Edlund U, Dånmark S, Albertsson AC 2008 ;A strategy ... Williams WA, et al 2007;Focal adhesion kinase signaling pathways regulate the osteogenic differentiation of human mesenchymal stem cells Exp Cell Res (1):22-37 101 Salasznyk RM, Klees RF, Boskey A, ...
- 9
- 423
- 0
Directed differentiation of human embryonic stem cells into haematopoietic and definitive endodermal lineages
Ngày tải lên :
04/10/2015, 16:03
... maintenance of hESC pluripotency has been re-iterated in recent studies detailing the derivation and maintenance of induced pluripotent stem (iPS) cells (Takahashi et al 2007; Takahashi and Yamanaka ... commercially available preparation of Activin A is preferred over Nodal as it is more stable and shows better induction of differentiation (Tada et al 2005) The ability of Activin A to generate either ... zebrafish gastrula also provide evidence for the existence of a hemangioblast population (Vogeli et al 2006) Detailed molecular characterization of hemangioblast cells has revealed an important...
- 296
- 2K
- 0