comparing the properties of neuronal culture systems a shopping guide for the cell biologist
the handbook of patient safety compliance a practical guide for
... initiative (such as a patient safety taxonomy and data aggregation tool), make certain that all consumers of the information understand what they are reading and how to use the information The ... designation from the Insurance Institute of America She is a past president of the American Society for Healthcare Risk Management and a member of the Maryland Society for Healthcare Risk Management ... of Betsy Lehman was emblematic of this approach In the aftermath of a catastrophic medication error at Dana Farber Cancer Institute, detailed evaluations were conducted by JCAHO and the Massachusetts...
- 289
- 339
- 0
Báo cáo sinh học: "Immediate transfection of patient-derived leukemia: a novel source for generating cell-based vaccines" ppt
... mouse cells, mouse Apo B was amplified using the primers 5' CACGTGGGCTCCAGCATT 3'and 5' TCACCAGTCATTTCTGCCTTTG 3' and the TaqMan hydrolysis probe 5'(FAM) CCAATGGTCGGGCACTGCTCAATA (TAMRA) 3' (courtesy ... neo amplification from non-nucleofected U2OS cells Nuclear DNA was harvested and amplified from separate samples, error bars indicate the standard deviation from the average of triplicate samples ... nuclear DNA was isolated from the nuclear fraction of cell lysates and PCR amplified using neo primers and a neo-specific TaqMan probe The total number of plasmid neo copies was calculated based...
- 13
- 256
- 0
optical properties of nanostructured metallic systems studied with the finite-difference time-domain method
... picture of a square array of rectangular holes of side ax and a y perforated on a free-standing metallic film of thickness h Parameter d defines the period of the array The apertures are illuminated ... microspheres), the optical properties of metamaterials made with stacked hole arrays and the guiding of metallic waveguides (and their focusing capabilities when tapered) These systems are thoroughly analyzed ... of Zaragoza, Spain 123 Author Dr Sergio G Rodrigo Departamento de Física de la Materia Condensada Instituto de Ciencia de Materiales de Aragón Universidad de Zaragoza 50009 Zaragoza Spain e-mail:...
- 177
- 381
- 0
Báo cáo toán học: "On the Tur´n Properties of Infinite Graphs a" pptx
... , , otherwise The meaning of the existence of tB (i) is similar as in Remark 2.3 Proof of Theorem 1.2 We start with an outline of the proof First, we redefine the sequence B by adding k to all ... graphs, o Publications of the Math Inst of the Hungarian Academy of Sci Ser A (1962), 441–456 [2] P Erd˝s, Problems and results in combinatorial analysis, Combinatorics (Proc Symp o Pure Math., ... some of the estimates made above Observe that our main “tool” was the fact that for any l there are integers m ∈ N and i ∈ {0, , k − 1} such that ni (m) ≤ l < ni+1 (m), and consequently that...
- 14
- 394
- 0
Báo cáo y học: "Immunomodulatory properties of mesenchymal stem cells: a review based on an interdisciplinary meeting held at the Kennedy Institute" potx
... On the other hand, MSCs may also actively participate in initiating AD [3], they have the potential to favour spread of melanoma metastases [4] and, although mostly immune privileged, they may ... ensure that bioassays include animal based, cellular and biochemical systems A model of vasculogenesis in a SCID mouse was presented as an example Conclusion The potential antiproliferative and immunodulatory ... KW, MacKenzie TC, Shaaban AF, Radu A, Moseley AM, Deans R, Marshak DR, Flake AW: Human mesenchymal stem cells engraft and demonstrate site-specific differentiation after in utero transplantation...
- 10
- 559
- 0
Tài liệu THE ELEMENTS OF BACTERIOLOGICAL TECHNIQUE A LABORATORY GUIDE FOR MEDICAL, DENTAL, AND TECHNICAL STUDENTS pptx
... bacteriological laboratory, so far as the glass apparatus is concerned, differs but little from that of a chemical laboratory, and the cleanliness of the apparatus is equally important The glassware comprised ... 21).—These are used for the collection and analysis of the gases liberated from the media during the growth of some varieties of bacteria and may be either plain (a) or graduated (b) A simple form ... Hot air (for the sterilisation of all glassware and of metal apparatus) (b) Moist Heat: Water at 56° C (for the sterilisation of certain albuminous fluids) Water at 100° C (for the sterilisation...
- 666
- 511
- 0
Tài liệu Báo cáo Y học: Differential response of neuronal cells to a fusion protein of ciliary neurotrophic factor/soluble CNTF-receptor and leukemia inhibitory factor pot
... longer than twice the diameter of the cell bodies appear within a day, and maximal response is reached in days For direct comparison, the amount of responsiveness was evaluated for all factors at 48 ... (even at high concentrations) alone were able to activate the MAPK pathway MAP kinases and STAT3 are rapidly activated within 10 in response to Hyper-CNTF, the phase of activation lasting for at ... virtually the same concentration as LIF and Hyper-IL-6 needed to achieve half-maximal activity The signaling events of stimulated BAF/3 cells reflected by the activation pattern of STAT3 and MAP...
- 9
- 442
- 0
Báo cáo khoa học: Zinc-binding property of the major yolk protein in the sea urchin ) implications of its role as a zinc transporter for gametogenesis ppt
... as a substrate for localization of the labeled MYP Statistical analysis Data were expressed as the mean ± SEM Statistical analysis was performed using instat software (GraphPad Software) The ... that in ovary at stage 1, and remained at a similar value to stage Testes at stage were not analyzed because of a lack of samples We calculated the amount of zinc bound to MYP in the gonad by multiplying ... on a shaker at °C, the solutions were withdrawn from each cell The zinc concentration of the solutions was measured by ICP-AES The data were analyzed using prism software (GraphPad Software, San...
- 14
- 442
- 0
The Help! Kit - A Resource Guide for Secondary Teachers of Migrant English Language Learners
... on any task, no matter how tedious And finally, the talented team of Donna Nalley and Tracy Hamilton at the SERVE office in Tallahassee did a fantastic job of making the Help! Kit as accurate and ... rural areas of their native countries or the U.S and often have a marginal level of education because they had to begin working at a young age and/or schools were unavailable The vast majority of ... information.) The family is essentially patriarchal, at least to outward appearances The roles of males and females are clearly defined—males are seen as the breadwinners, decision-makers, and...
- 251
- 484
- 0
The Privatization of Italian Savings Banks – A Role Model for Germany?* doc
... remained roughly constant (Table 1) At the same time, the profitability of Italian banks has soared; that of German banks has dropped (Figure 1) The Italian Privatization of Savings Banks1 3.1 The ... and 2002 shows that the savings banks outperformed all other bank groups The performance of the cooperative banks was also above average In contrast, the mean ROE at the largest commercial banks ... legally separating the banking business from social or cultural activities These foundations maintained the public mandate of the savings banks, such as the advancement of the local economy These...
- 19
- 469
- 0
The Book of Xen: A Practical Guide for the System Administrator doc
... Linux, and it’s stable and easy to manage Red Hat’s effort shows to particular advantage in the work they’ve done integrating Xen Red Hat has taken Xen and done a fair amount of work to make it a ... Xen offers some advantages to both the system administrator and the home user Xen is a piece of software that enables one machine to behave as if it were many virtual machines Each of these machines ... Preliminary results in “Xen and the Art of Virtualization”—one of the seminal Xen papers— indicated performance degradation of less than percent for a standard workload and between 10 and 20 percent...
- 316
- 3,560
- 0
the chemical laboratory its design and operation a practical guide for planners of industrial, medical, or educational facilities
... ventilation may be required ANALYTICAL BALANCES Analytical balances are among the prima donnas of the laboratory, requiring separate and unequal treatment They refuse to cooperate if there is the ... was installed against a wall and the hot air was drawn off overhead The heat radiating from 12 flasks and heaters, however, made the workers on the other side ofthe narrow room very uncomfortable ... scale drawing of the laboratory area For a building in the planning stages, the architect's drawing can be used For an ex- Laboratory Layout 19 isting building, any drawing already available should...
- 173
- 561
- 0
a field guide for science writers the official guide of the national association of science writers sep 2005
... see the image of the galaxy as it was 100 years ago.” The pattern is A B, B–C, C–D The AB/BC rule also works on the mid-scale, with paragraphs In fact, the rule is just another way of making transitions ... Meetings are the most efficient way to connect with a lot of sources The biggest, at least for the diversity of topics offered, is the annual meeting of the American Association for the Advancement of ... Usually, full tables of contents are also available, as well as full text of the articles Nature has its own press access Web portal The American Physical Society offers an open Web page that alerts...
- 336
- 363
- 0
Báo cáo hóa học: " Properties of nanocones formed on a surface of semiconductors by laser radiation: quantum confinement effect of electrons, phonons, and excitons" pptx
... localized at the surface of Si like a thin film As a result, LRA stage gradually transits to SLA stage The second stage, SLA, is characterized by formation of nanocones on the irradiated surface of a ... experiment All of the authors participated to the analysis of the data and wrote the article AMy carried out the sample preparation, the measurements for solid solutions of CdZnTe PO carried out the sample ... nanocavities [17] At the second stage of the process, nanocones are formed on the irradiated surface of the semiconductors due to plastic deformation of the top layer in the same way as in the...
- 6
- 489
- 0
A framework of knowledge management systems issues and challenges for theory and practice
... with the domain, they may not have an accurate first-hand understanding of the content Hence, the keywords and meta-data tags appended by the knowledge librarian may be inappropriate and as a result ... conducted in the offices of the managers and, in most cases, the managers arranged for a demonstration of the system so that we could see the features of the KMS implementation The length of the interviews ... instance, may not be appropriate For example, with traditional systems, the domain data is structured into a conceptual schema that is translated into a data model The resulting data model rarely...
- 11
- 369
- 0
Báo cáo y học: "Development of a practical guide for the early recognition for malignant melanoma of the foot and nail unit" potx
... verruca plantaris: a case report Dermatol Online J 2006, 12 36 Virgili A, Corazza M: Guess what! Metastatic malignant melanoma of the leg from a warty acral amelanotic malignant melanoma Eur ... Dawber RP, Colver GB: The spectrum of malignant melanoma of the nail apparatus Semin Dermatol 1991, 10:82-87 22 Franke W, Neumann NJ, Ruzicka T, Schulte K: Plantar malignant melanoma - a challenge ... cutaneous melanoma Br J Dermatol 2002, 146:7-17 62 Australian Cancer Network Melanoma Guidelines Revision Working Party: Clinical Practice Guidelines for the management of melanoma in Australia...
- 4
- 403
- 0
First principles investigation on transport properties of graphene based systems
... observed as a significant change in the electrical resistance depending on whether the magnetization of adjacent ferromagnetic layers are in a parallel or an antiparallel alignment Normally, the overall ... function of the number of carbon atoms in the chain The inset shows amount of transferred charge per carbon atom as a function of the length of the chain in the chain Both of them show an oscillatory ... with Na = 3p + (Na is the number of carbon dimers of AGNR, p is integer) show the smallest gap compared to the other two families The bandgap calculated based on GW approximation shows the same...
- 191
- 472
- 0
Establishment of autologous culture systems for human embryonic stem cells
... Cao Y, Xiao R, and Cao T Establishment of Autologous Feeders for Human Embryonic Stem Cells Propagation 2nd Meeting of IADR Pan Asian Pacific Federation (PAPF) and the 1st Meeting of IADR Asia/Pacific ... types of human body Therefore, study of the cellular and molecular properties of hESCs provides information in the culture, differentiation and applications of hESCs A review of the current signaling ... research (2) ESCs can differentiate into virtually all the cell types of the body, providing a valuable tool for differentiation and generation of broader range of cell types than other stem cells...
- 214
- 481
- 0
Outsourcing of knowledge based systems a knowledge sharing perspective
... (McFarlan & Nolan, 1995) assumed a strategic alliance to be the result of an outsourcing arrangement, and argued that the ongoing management of an alliance was the single most important aspect of ... one of the ways that “measure the degree to which a capability can be easily communicated and understood.”, and found that the 33 more codifiable and teachable a capability, the high the risk of ... Zahra and George’s article (2002) proposed a reconceptualization of absorptive capacity that contains dimensions/capabilities, which are: acquisition, assimilation, transformation and exploitation...
- 79
- 245
- 0
Assessment of pretreatments and enzymatic hydrolysis of wheat straw as a sugar source for bioprocess industry
... fragments and acetyl groups are removed forming acetic acid Organic solvent such as acetone can be used to precipitate and separate the fractionated biomass The pretreatment has an advantage of operating ... such as α-arabinofuranosidases and α-Larabinases that release arabinan [31], α-glucuronidases that release glucoronic acids, acetyl xylan esterases that hydrolyze acetylester bonds, ferulic acid ... crystallinity of wheat straw cellulose makes it a good substrate for enzymatic saccharification [25] as well as a suitable host polymer for preparation of cellulose derivatives [28] In epidermis cell...
- 20
- 437
- 0
Tìm thêm: khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25