comparative proteome analysis of a human liver cell line stably transfected with hepatitis d virus full length cdna
Báo cáo khoa học: Proteome analysis of a rat liver nuclear insoluble protein fraction and localization of a novel protein, ISP36, to compartments in the interchromatin space pptx
... incubated with anti-His sera and then alkaline phosphatase-conjugated secondary antibodies, and developed with 5-bromo-4-chloro-3-indolyl phosphate (B) Purified His6-ISP36 (B1–B3) and a rat liver ... were developed with H2O2 and diaminobenzidine (B) A rat liver nuclear fraction was treated with DNase–RNase and the solubilized fraction (chromatin fraction, B5) was separated by centrifugation ... that associates with nuclear matrix DNA Cell Biol 17, 849–858 Lee JY, Nakane Y, Koshikawa N, Nakayama K, Hayashi M & Takenaga K (2000) Characterization of a zinc finger protein ZAN75: nuclear...
- 12
- 400
- 0
Báo cáo y học: "SOX9 transduction of a human chondrocytic cell line identifies novel genes regulated in primary human chondrocytes and in osteoarthritis" docx
... CGAGTTGTTTCCTCGCTGATC GCAATGGAATTCAACATAAGCAAA CRTL1 TTCCACAAGCACAAACTTTACACAT GTGAAACTGAGTTTTGTATAACCTCTCAGT CRLF1 AACGGCCATAACAGCTCTGACT ACTCAACCAACCCTCACACACA MYBPH AGGCCTACAGTCAAACTCCAGAGA ... TTCCACAAGCACAAACTTTACACAT S10 0A1 CCAGGAGTATGTGGTGCTTGTG ATGTGGCTGTCTGCTCAACTGT RGC32 GACAAAGACGTGCACTCAACCTT ACTGTCTAAATTGCCCAGAAATGG SRPX TGGCTGGTTGATTTTGTAGAGAAA TAGAAAAGAGTTAGGTGTCACATTGAATAA ... normal and OA cartilage and produced the cDNA libraries from femoral cartilage CMR undertook the laboratory work associated with real time PCR analysis of the normal and OA cartilage libraries PDC...
- 10
- 387
- 0
Báo cáo sinh học: " Kinetics of antibody-induced modulation of respiratory syncytial virus antigens in a human epithelial cell line" docx
... were detected by adding anti-RSV IgG and incubated h at 37°C Afterwards, cells were washed and viral proteins visualized by indirect immunofluorescence as described Controls were as described for ... image of intracellular RSV proteins HEp-2 cells had been infected and then incubated for various times with anti-RSV IgG were permeabilized, fixed with acetone and methanol and anti-RSV added The ... showed that anti-RSV IgG incubation induced the removal and re-appearance of intracellular viral pro- Figure Confocal laser scanning image of intracellular RSV proteins Confocal laser scanning image...
- 9
- 403
- 0
Báo cáo hóa học: " Kinetics of antibody-induced modulation of respiratory syncytial virus antigens in a human epithelial cell line" pot
... were detected by adding anti-RSV IgG and incubated h at 37°C Afterwards, cells were washed and viral proteins visualized by indirect immunofluorescence as described Controls were as described for ... image of intracellular RSV proteins HEp-2 cells had been infected and then incubated for various times with anti-RSV IgG were permeabilized, fixed with acetone and methanol and anti-RSV added The ... showed that anti-RSV IgG incubation induced the removal and re-appearance of intracellular viral pro- Figure Confocal laser scanning image of intracellular RSV proteins Confocal laser scanning image...
- 9
- 330
- 0
Báo cáo hóa học: " Research Article Modelling and Comparative Performance Analysis of a Time-Reversed UWB System" doc
... SIMULATED AND ESTIMATED RESULTS All-RAKE and TR-UWB simulations were adapted from a time hopped PPM UWB simulation by Di Benedetto and Giancola [32] The cardinality and periodicity of each time ... exhibited by the system is defined as a statistically independent zero mean Gaussian random variable The ISI and MUI terms may be brought under the standard Gaussian approximation provided that the ... than the base waveform width, and to allow an encoded signal to be orthogonal to its nonencoded counterpart All users had equal transmit powers of mW, and equal data rates which were adjusted...
- 11
- 333
- 0
Báo cáo hóa học: " Non-monotonic changes in clonogenic cell survival induced by disulphonated aluminum phthalocyanine photodynamic treatment in a human glioma cell line" pot
... of phthalocyanine and drafting of the manuscript VJ conceived the study and participated in its design and coordination and helped in interpretation of data and drafting the manuscript TKS made ... study, made contributions to acquisition, analysis and interpretation of data Page 12 of 14 and helped to draft the manuscript KM helped in the interpretation of the data on uptake and localization ... fraction and energy (KJ) was quantified by modeling the data with a univariate linear regression analysis with energy being an independent variable and surviving fraction as dependent variable...
- 14
- 521
- 0
Báo cáo hóa học: " Respiratory syncytial virus glycoproteins uptake occurs through clathrin-mediated endocytosis in a human epithelial cell line" docx
... unbound antibody was washed away and the cells were finally mounted in VectaShield Propidium Iodide medium and analysed on an Olympus FV1000 confocal microscope RSV antigens and nuclei appear in ... sulfoxide (DMSO), methyl-beta-cyclodextrin (MBCD) or monodansylcadaverine (MDC) The cells were fixed/permeabilized with ice-cold methanol:acetone and incubated with anti-goat IgG-FITC antibody Later, ... clathrin-mediated uptake in any RSV-related mechanism was not clear until recently Knockdown of genes associated with clathrin-mediated endocytosis as well as the expression of dominant-negative...
- 4
- 231
- 0
Báo cáo y học: "Accuracy of hyaluronic acid level for predicting liver fibrosis stages in patients with hepatitis C virus" pptx
... IA, ARA and DO were responsible for the patient drafting, carried out biochemical analysis, participated in the coordination of the study, and drafted the paper GP performed the statistical analysis ... Laudat A, Loria A, Serfaty L, Poupon R, Giboudeau J: Diagnostic accuracy of hyaluronan and type III procollagen amino-terminal peptide serum assays as markers of liver fibrosis in chronic viral ... included 405 patients Table shows the patient characteristics at the time of liver biopsy The training and validation sets did not significantly differ in any of the assessed variables Of the patients,...
- 7
- 328
- 0
báo cáo hóa học:" Lentivirus-mediated RNAi silencing targeting ABCC2 increasing the sensitivity of a human nasopharyngeal carcinoma cell line against cisplatin" docx
... Note: 1, animals with CNE2 treated with cisplatin 2, animals with CNE2 treated with normal saline 3, animals with CNE2/shABCC2-1 treated with cisplatin 4, animals with CNE2/shABCC2-1 treated with ... [21] Statistic analysis The data of quantitative RT-PCR, MTT, IC50, intracellular accumulation of cisplatin and the relative tumor size were expressed as mean ± SD value Statistical analysis ... normal saline 5, animals with CNE2/shABCC2- treated with cisplatin 6, animals with CNE2/shABCC2- treated with normal saline Page of (page number not for citation purposes) Journal of Translational...
- 9
- 509
- 0
Báo cáo khoa học: "Comparative growth analysis of five first year establishment poplar clones (Populus sp.) grown under a short-rotation intensive culture system" docx
... already culminated around Julian date 247 Beaupré (Fig 2) Maximum leaf area was reached around Julian date 286, Raspalje and Beaupré having considerably higher leaf areas ) (about m than the other ... leaf and wood biomass productions Leaf area was calculated from allometric relations between leaf area and leaf dimensions Seasonal growth was also analyzed in terms of relative growth rate (RGR), ... Robusta ended around Julian date tively 169 and 180 height growth early 261 (Fig.1) ) Stem diameter was the largest with and Raspalje (20 and 22 mm), while the diameter growth of Robusta had already...
- 6
- 205
- 0
Báo cáo y học: " A comparative analysis of HIV drug resistance interpretation based on short reverse transcriptase sequences versus full sequences" pps
... performed the analysis and prepared the manuscript MB assisted in drafting the manuscript EvC and KvdB performed the analysis BW took care of the statistical analysis WS, CW and TRdW and LS assisted ... South Africa 6Department of Health Intelligence, PharmAccess Foundation and Amsterdam Institute for Global Health and Development, Academic Medical Center, University of Amsterdam, Amsterdam, The ... Chaiwarith R, Wachirakaphan C, Kotarathititum W, Praparatanaphan J, Sirisanthana T, Supparatpinyo K: Sensitivity and specificity of using CD4+ measurement and clinical evaluation to determine antiretroviral...
- 9
- 366
- 0
Báo cáo y học: "Proteome analysis of bronchoalveolar lavage in Pulmonary Langerhans cell histiocytosis" pptx
... qualitative and quantitative differences Statistical analysis Statistical analysis of the samples was performed using Statistical software packages SPSS 13.0 for Windows and Graphpad Prism for Windows ... at one Alkylation of cysteine by carbamidomethylation was assumed and oxidation of methionine was considered as a possible modification Sequence coverage, number of matched peptides and probability ... literature on SPB3 and smoke-induced lung damage Multivariate analysis Multivariate statistical analysis by PCA was used to examine global trends in protein expression in BAL of PLCH patients and...
- 34
- 298
- 0
Báo cáo y học: "Dynamic simulation of red blood cell metabolism and its application to the analysis of a pathological condition" docx
... the oxidantinduced decrease of hexokinase and pyruvate kinase, and the maximum activity of these enzymes was allowed to change according to the ratio of GSH and GSSG The equations and parameters ... Lactate dehydrogenase Lactate transport process Leak of Potassium Leak of Sodium Sodium/potassium pump Adenosine transport process AMP phosphohydrolase Adenosine deaminase Adenosine kinase Adenylate ... This hybrid dynamic/static simulation method combines dynamic rate equations with a flux-based approach and as a result reduces the numbers of rate equations and parameters that are needed by up...
- 11
- 386
- 0
Báo cáo y học: "Genetic analysis of the human infective trypanosome Trypanosoma brucei gambiense: chromosomal segregation, crossing over, and the construction of a genetic map" doc
... approved the final manuscript 14 15 16 Additional data files The following additional data are available with this paper Additional data file provides segregation data Additional data file provides ... size geneticdatalines1T.are onTherecombinationforofandforestimated tionmap.marker.thederivedindividualindividual386outsideforlinefor mapofandaveragerecombination isolatefrommarkersbased everylinkmosomesInheritancegenotypingalleles ... 13 Authors' contributions AC, ATa, MT and AML designed the experiments, analyzed the data, and wrote the manuscript AC, LS, ATw, and LM carried out the experimental work All authors read and approved...
- 12
- 281
- 0
A comprehensive proteome analysis of hepatitis b virus associated hepatocellular carcinoma
... Isotope-coded affinity tag CyDye Cyanine fluorescent dye Da Dalton DMSO Dimethyl sulfoxide DNA Deoxyribonucleic acid DTT Dithiothreitol EDTA Ethylenediaminetetraacetic acid FAP Familial adenomatous ... microarray analysis maybe promising, a single-set analysis may lead to false findings The use of data integrations in meta -analysis was suggested to help identify molecular alterations and pathways ... This study also described changes in metabolism and anti-oxidative activities In another study, 2-DE analysis was conducted on an anti-cancer drug, cell differentiated agent II (CDAII), to analyse...
- 430
- 433
- 0
A multiplex comparative proteomic analysis of hypoxia influence in the presence and absence of p53 in HCT116 cells
... that in turn “protects” radiation-damaged DNA from restoring to an undamaged state Stable DNA damage accumulates and leads to an increased lethality from a given dose of radiation in cells, inducing ... bHLH domain and the PAS domain with PAS -A and PAS-B repeats, are localized at the Nterminus of HIF-1α At its C terminus, there are two transactivation domains (N-TAD and C-TAD) and an oxygen-dependent ... hypoxia (Nakayama et al., 2004) The DNA binding and transcriptional activity of HIF-1 is also oxygendependently regulated by the hydroxylation of a critical asparagine residue (Asn803) located within...
- 134
- 287
- 0
INTERLEUKIN 6 RELEASE FROM t98g HUMAN GLIAL CELL LINE AS a PREDICTIVE MARKER FOR CHRONIC PAIN, AND THE CHARACTERIZATION OF SUBSTANCE(S) INVOLVED IN PAIN
... hyperalgesia, and also attenuates pain due to prostaglandins In addition, Joseph et al (2007) found increased levels of ppN/OFQ, N/OFQ and NST in the brains of rats with partial sciatic nerve ligation ... Cerebrospinal Fluid DAPI 4',6-diamidino-2-phenylindole DMEM Dulbecco's Modified Eagle Medium DRG Dorsal Root Ganglia DSRB Domain Specific Review Board DTT Dithiothreitol EBSS Earle's Balanced Salt Solution ... chronic pain Amino acids and prostaglandins are two such examples 1.2.1.1 Amino Acids Glutamate is the main excitatory amino acid in the mammalian CNS Its interaction with glutamate receptors mediates...
- 136
- 600
- 0
Economic feasibility analysis of a wind farm in Caldas da Rainha, Portugal
... understand the behavior of the variables involved in economical and financial assessing of a wind farm as a manner of validating the indicators of attractiveness and risk of energy projects and ... International Clean Energy Project Analysis in order to make an analysis of economic and financial viability of wind energy project located in Caldas da Rainha Results and comparisons By comparing ... prices are updated yearly by the inflation rate considered in the analysis Table 14 Comparison in absolute values of calculated parameters in the scenarios Mean values in € of the calculated parameters...
- 14
- 416
- 1
Computational fluid dynamics analysis of a twisted airfoil shaped two-bladed H-Darrieus rotor made from fibreglass reinforced plastic (FRP)
... given Steady state segregated solver with absolute velocity formulation and cell- based grid was considered, and a standard k-ε viscous model with standard wall functions was chosen A first order upwind ... the guidance of Prof Rajat Gupta His area of interest is in the field of fluid dynamics and its application, wind energy E-mail address: sukantamech07@gmail.com Agnimitra Biswas is a PhD student ... 18 and 19, it is found that, for H /D ratio 1.80, the maximum Cp obtained is 0.59 at a TSR of 0.888 and maximum Ct obtained is 0.066 at a TSR of 0.888 and the standard deviations of Cp and Ct are...
- 16
- 364
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25