0

clues from the biophysical characteristics of sp b and sp c

Defining Public Administration: Selections from the International Encyclopedia of Public Policy and Administration doc

Defining Public Administration: Selections from the International Encyclopedia of Public Policy and Administration doc

Cao đẳng - Đại học

... prohiematic becausc of < /b> the < /b> histr~ricili and theoretical ex- clusion of < /b> w m e n from < /b> the < /b> public sphere, which has barred issues such as the < /b> division of < /b> household labor from < /b> policy debate The < /b> administrative ... countering hierarchical and impersonal f ""red tape,'%tc.) aspects; and continued concern about responsibility and accountability to the < /b> citizenry and its interests The < /b> practice of < /b> public admir7istration ... h t a account; public admkistratj,n is prdbably best defined as the < /b> practice and study of < /b> the < /b> professional formulation and influence of < /b> public policy and the < /b> implementation of < /b> such policy on a...
  • 465
  • 388
  • 0
Báo cáo khoa học: Spectroscopic investigation of the reaction mechanism of CopB-B, the catalytic fragment from an archaeal thermophilic ATP-driven heavy metal transporter potx

Báo cáo khoa học: Spectroscopic investigation of the reaction mechanism of CopB-B, the catalytic fragment from an archaeal thermophilic ATP-driven heavy metal transporter potx

Báo cáo khoa học

... rate of < /b> ATP from < /b> its caged precursor molecule The < /b> time course of < /b> the < /b> difference band corresponds to rates of < /b> and s)1 in the < /b> presence or absence of < /b> CopB -B, respectively, which demonstrates that the < /b> ... difference spectra of < /b> nucleotides in the < /b> presence and absence of < /b> CopB -B leads to the < /b> conclusion that the < /b> phosphate groups of < /b> ATP apparently not contribute signicantly to the < /b> formation of < /b> the < /b> nucleotideprotein ... approximately Nucleotide binding to CopB -B In order to precisely dene the < /b> reaction conditions of < /b> the < /b> spectroscopically observed CopB -B reaction with ATP, the < /b> interaction of < /b> nucleotides with CopB -B was...
  • 15
  • 441
  • 0
Báo cáo khoa học: Synthesis of b-mannosides using the transglycosylation activity of endo-b-mannosidase from Lilium longiflorum pptx

Báo cáo khoa học: Synthesis of b-mannosides using the transglycosylation activity of endo-b-mannosidase from Lilium longiflorum pptx

Báo cáo khoa học

... Product Manb1–4GlcNAcb1-pNP Manb-Manb-GlcNAcb1-pNP Manb-Glcb1-pNP Manb-Manb-Glcb1-pNP Manb-Manb1-pNP M 3C- PA, M 4B- PA and M5A-PA has been reported previously [23] Transglycosylation activity of < /b> endob-mannosidase ... characteristic of < /b> this transglycosylation is the < /b> transfer of < /b> the < /b> Man residue to various acceptor substrates including GN2-PA, pNP b- GlcNAc, pNP b- Glc and pNP b- Man (Figs 2B and 4, Tables and 4) Because ... used as a donor substrate and pNP b- GlcNAc, pNP b- GalNAc, pNP b- Glc and pNP b- Man were used as acceptor substrates In the < /b> presence of < /b> 140 mm M1-peptide and 80 mm of < /b> each pNP monosaccharide, transmannosylation...
  • 9
  • 576
  • 0
Báo cáo y học:

Báo cáo y học: "Flow cytometric assessment of the signaling status of human B lymphocytes from normal and autoimmune individuals" doc

Báo cáo khoa học

... blood cells, has been challenging because of < /b> the < /b> large number of < /b> cells needed for biochemical assessment of < /b> signaling status and the < /b> relatively poor efficiency of < /b> transfection of < /b> primary cells Recent ... phosphospecific I B mAb (Ser 32/ser 36; Cell Signaling Technologies) or the < /b> isotype-matched control MOPC (ATCC) Cells were washed and blocked as above before incubation for 30 at 4 C in the < /b> dark ... intracellular flow cytometric analysis of < /b> I B isoforms (-α, -β, -ε) and the < /b> phosphorylation status of < /b> I B R2G6 cells (3 × 105) were incubated with rCD154 in the < /b> presence or absence of < /b> 30 µM of < /b> the...
  • 11
  • 479
  • 0
Báo cáo khoa học:

Báo cáo khoa học: " Hepatitis B virus genotypes and evolutionary profiles from blood donors from the northwest region of China" docx

Báo cáo khoa học

... H: Characteristics < /b> of < /b> circulating T cell receptor gamma-delta T cells from < /b> individuals chronically infected with hepatitis B virus (HBV): an association between V(delta)2 subtype and chronic HBV ... reactive sample counts of < /b> each pool in the < /b> first round of < /b> detection; blank represents HBV-reactive sample counts and black is the < /b> total sample counts in the < /b> pool; B, lower HBV DNA copies of < /b> reactive ... reference sequences, which proves the < /b> high mutation rate of < /b> HBV A DL2000 10 11 281bp 132bp 109bp Counts of < /b> samples B B C D Genotype of < /b> HBV Figure of < /b> HBV reactive blood donors Genotyping Genotyping of...
  • 7
  • 351
  • 0
Study of contaminants stemmed from the waste water of the Ivorian Refining Company

Study of contaminants stemmed from the waste water of the Ivorian Refining Company

Môi trường

... are [2, 3]: Micrococcus, Corynebacteria, Pseudomonas, Acinetobacter, Alcaligenes, Vibro, Flavobacterium, Achromobacter, and Nocardia Among these bacteria, only the < /b> acinetobacter and the < /b> pseudomonas ... heavy crude oil called Ebur The < /b> composition of < /b> the < /b> Ebur has been determined by means of < /b> a GC/MS analysis and the < /b> results are shown on the < /b> Table Table Composition of < /b> the < /b> Ebur crude oil in ppm Carbons ... suspension because of < /b> their surface potential (clay) 6) The < /b> flocculator After the < /b> API stage, the < /b> water is pumped and sent to the < /b> flocculator where flocculants (cationic polymers and carboxymethyl cellulose)...
  • 10
  • 509
  • 0
Tài liệu The Investing Secrets of Warren Buffett—and how to profit from them pptx

Tài liệu The Investing Secrets of Warren Buffett—and how to profit from them pptx

Quản lý dự án

... protect them from < /b> invaders, so companies can have economic moats to protect them from < /b> challenges of < /b> competitors and changes in consumer preferences The < /b> moat can be made up of < /b> attributes such as brand ... am able to scan the < /b> universe of < /b> 6000 stocks, eliminate the < /b> majority of < /b> them and focus on my circle of < /b> competence I then have 10 years of < /b> data on the < /b> stocks in my universe and can create scenarios ... experience of < /b> our Conscious Investor subscribers from < /b> around the < /b> world shows just how successful the < /b> Conscious Investor team and I have been In a recent survey almost 80 percent of < /b> subscribers said...
  • 27
  • 618
  • 1
Tài liệu Báo cáo khoa học: Stefin A displaces the occluding loop of cathepsin B only by as much as required to bind to the active site cleft doc

Tài liệu Báo cáo khoa học: Stefin A displaces the occluding loop of cathepsin B only by as much as required to bind to the active site cleft doc

Báo cáo khoa học

... amide and the < /b> cathepsin B S25 carbonyl group The < /b> second binding loop (L73–D79) comes down to the < /b> area beyond the < /b> S2¢ site and displaces the < /b> occluding loop residues of < /b> cathepsin B It is firmly anchored ... together by the < /b> disulfide bond between C1 08 and C1 19 Its attachment to the < /b> body of < /b> the < /b> enzyme is stabilized by two salt bridges, between H110 and D22, and between R116 and D224 The < /b> crystal structure ... layer of < /b> solvent molecules mediates the < /b> contacts between the < /b> C- terminal part of < /b> the < /b> second binding loop and cathepsin B The < /b> occluding loop differs from < /b> the < /b> native structure [Protein Data Bank (PDB)...
  • 8
  • 632
  • 0
Tài liệu Báo cáo khoa học: Template requirements and binding of hepatitis C virus NS5B polymerase during in vitro RNA synthesis from the 3¢-end of virus minus-strand RNA docx

Tài liệu Báo cáo khoa học: Template requirements and binding of hepatitis C virus NS5B polymerase during in vitro RNA synthesis from the 3¢-end of virus minus-strand RNA docx

Báo cáo khoa học

... GGCTGCACGACACTCCGCCATGGCTAGACGCTTTC CGTCTAGCCATGGCGGAGTGTCGTGCAGCCTCCAGG CCCCTGATGGGGGCGTATTTCCACCATGAATCACTCCCC GTGATTCATGGTGGAAATACGCCCCCATCAGGGGGCTGG TTTTGCGGCCGCGCCAGCCCCCTGATGGGGGCGCAGCCTCCAGGA ... TTTTGCGGCCGCGCCAGCCCCCTGATGGGGGCGCAGCCTCCAGGA CCCCCCCTCCCGGGAGAGCCATAGTGGTCTGCGGAACCGGTTTT AAAAACCGGTTCCGCAGACCACTATGGCTCTCCCGGGAGGGGGGG TCCTGGAGGCTGCGCCCCCATCAGGGGGCTGGCGCGGCCGCAAAA TAATACGACTCACTATAGGGGCACGCCCAAATCTC GCCAGCCCCCTGATGGGGGCGA ... GCCAGACACTCCACCATGAATCACTCCCCTGTGAGGAACTACTGTCTTCACG TAATACGACTCACTATAGGGTGCACGGTCTACGAGACCT TTTGCGGCCGCGCCAGCCCCCTGATGGGGGCGACACTCCACCATGAATTCT AGCCATGGTTT AAACCATGGCTAGAATTCATGGTGGAGTGTCGCCCCCATCAGGGGGCTGGC GCGGCCGCAAA...
  • 15
  • 597
  • 0
Tài liệu Báo cáo khoa học: Different modes of dipeptidyl peptidase IV (CD26) inhibition by oligopeptides derived from the N-terminus of HIV-1 Tat indicate at least two inhibitor binding sites doc

Tài liệu Báo cáo khoa học: Different modes of dipeptidyl peptidase IV (CD26) inhibition by oligopeptides derived from the N-terminus of HIV-1 Tat indicate at least two inhibitor binding sites doc

Báo cáo khoa học

... the < /b> peptide backbone of < /b> the < /b> inhibitor or speci c interactions between the < /b> inhibitor and the < /b> bound substrate On the < /b> basis of < /b> the < /b> active site-containing 3D model of < /b> the < /b> C- terminal region of < /b> DP IV ... hydrogen bonds were formed between the < /b> backbone carbonyl group of < /b> Val4 of < /b> the < /b> peptide and the < /b> backbone amide hydrogen of < /b> Ala743 of < /b> the < /b> enzyme, between the < /b> side chain carbonyl group of < /b> Asn7 of < /b> Tat(1–9) ... difference of < /b> the < /b> Km values of < /b> the < /b> hydrolysis of < /b> both substrates, the < /b> factors a and d were reduced using Gly-Pro-R110-CO-(CH2)4Cl Therefore, in the < /b> presence of < /b> the < /b> latter substrate, a decreased substrate...
  • 10
  • 505
  • 0
Older Persons in Cambodia: A Profile from the 2004 Survey of Elderly pot

Older Persons in Cambodia: A Profile from the 2004 Survey of Elderly pot

Sức khỏe người cao tuổi

... judge the < /b> adequacy of < /b> the < /b> 2004 Survey of < /b> Elderly in Cambodia (SEC) sample, we compare the < /b> basic demographic characteristics < /b> of < /b> the < /b> respondents in the < /b> SEC with results from < /b> three independent sources ... 2004) and limited to the < /b> provinces covered by the < /b> SEC sample, the < /b> percentages who ever attended school are reasonably similar in the < /b> two sources Overall the < /b> comparison of < /b> basic demographic characteristics < /b> ... 31.1 (a) includes violence, disappearance, illness, accident and other causes (b) includes violence and disappearance Given the < /b> virtual absence of < /b> formal channels for care and support of < /b> the < /b> older...
  • 82
  • 435
  • 0
Accounting for Changes in Social Support Among Married Older Adults: Insights From the MacArthur Studies of Successful Aging pptx

Accounting for Changes in Social Support Among Married Older Adults: Insights From the MacArthur Studies of Successful Aging pptx

Kế toán - Kiểm toán

... could alter the < /b> relative availability and efficiency of < /b> different types of < /b> support because of < /b> changes in the < /b> availability of < /b> certain types of < /b> ties (Connidis & Davies, 1990; Peters, Hoyt, Babchuk, ... a sample of < /b> 439.1 Table summarizes the < /b> sociodemographic and psychological characteristics < /b> of < /b> the < /b> sample at the < /b> time of < /b> the < /b> first interview The < /b> majority of < /b> the < /b> sample was White (83%; the < /b> remainder ... on the < /b> basis of < /b> age and both physical and cognitive functioning from < /b> three community-based cohorts of < /b> the < /b> National Institute on Aging’s Established Populations for Epidemiologic Studies of < /b> the...
  • 10
  • 449
  • 0
Báo cáo khoa học: Degradation of chitosans with chitinase B from Serratia marcescens Production of chito-oligosaccharides and insight into enzyme processivity docx

Báo cáo khoa học: Degradation of chitosans with chitinase B from Serratia marcescens Production of chito-oligosaccharides and insight into enzyme processivity docx

Báo cáo khoa học

... many other chitinolytic bacteria, the < /b> Gram-negative soil bacterium Serratia marcescens produces multiple chitinases (ChiA, ChiB, ChiC1 and ChiC2) [1214] These enzymes all belong to family 18 chitinases, ... frequencies and block lengths of < /b> each chitosan are compared with the < /b> calculated diad frequencies and block lengths of < /b> a chitosan with a random (Bernoullian) distribution of < /b> A- and D-units (numbers ... known random distribution of < /b> A- and D-units are useful substrates for obtaining deeper insight into the < /b> mode of < /b> action of < /b> ChiB, including its processive character The < /b> catalytic mechanism of < /b> ChiB requires...
  • 12
  • 474
  • 0
Cell Biology and Cancer under a contract from the National Institutes of Health doc

Cell Biology and Cancer under a contract from the National Institutes of Health doc

Sức khỏe giới tính

... beginning the < /b> activity • The < /b> Basic Science-Public Health Connection describes how the < /b> activity illustrates the < /b> rela tionship between basic science and personal and public health The < /b> mission of < /b> the < /b> ... enhanced understanding of < /b> the < /b> nature and methods of < /b> science, and (3) to recognize the < /b> role Figure 11 Conceptual Flow of < /b> the < /b> Activities Major Concept Activity Activity The < /b> Faces of < /b> Cancer Cancer ... research; and •­ collecting and disseminating information about cancer The < /b> NCI was established under the < /b> National Cancer Act of < /b> 1937 The < /b> National Cancer Act of < /b> 1971 broad ened the < /b> scope and responsibilities...
  • 164
  • 578
  • 0
Aesthetic Separation, Aesthetic Community: Scenes from the Aesthetic Regime of Art pptx

Aesthetic Separation, Aesthetic Community: Scenes from the Aesthetic Regime of Art pptx

Thời trang - Làm đẹp

... discourse of < /b> the < /b> ‘political artist’ with both the < /b> shabby aspect of < /b> the < /b> muddy street or the < /b> apparently unconcerned circulation of < /b> the < /b> inhabitants and the < /b> abstractedness of < /b> the < /b> patches of < /b> colours on the < /b> ... the < /b> fabric of < /b> common experience that change the < /b> cartography of < /b> the < /b> perceptible, the < /b> thinkable and the < /b> feasible As such, it allows for new modes of < /b> political construction of < /b> common objects and new ... of < /b> the < /b> works fitted a certain order of < /b> the < /b> bodies, a certain harmony between the < /b> places and functions of < /b> a social order and the < /b> capacities or incapacities of < /b> the < /b> bodies located in such or such...
  • 15
  • 297
  • 0
101 Quick and Easy Ideas Taken from the Master Photographers of the Twentieth Century

101 Quick and Easy Ideas Taken from the Master Photographers of the Twentieth Century

Chụp ảnh - Quay phim

... can replicate Abbott’s work in her second photo of < /b> the < /b> barbershop by photographing a vintage barbershop in your area Abbott took her shot by standing on the < /b> curb just to the < /b> right of < /b> the < /b> barbershop ... Rule of < /b> Thirds (placing prominent subjects/objects a third of < /b> the < /b> way over from < /b> the < /b> either edge or the < /b> top/bottom of < /b> the < /b> frame), he did make an effort to place subjects/objects off center in the < /b> ... You can see an oil derrick to the < /b> right of < /b> the < /b> burning area and a bare tree to the < /b> left The < /b> Rockies sit in the < /b> background, extending about a sixth of < /b> the < /b> way from < /b> the < /b> bottom of < /b> the < /b> frame Parts of...
  • 254
  • 3,126
  • 0
Báo cáo khoa học: Nautilin-63, a novel acidic glycoprotein from the shell nacre of Nautilus macromphalus doc

Báo cáo khoa học: Nautilin-63, a novel acidic glycoprotein from the shell nacre of Nautilus macromphalus doc

Báo cáo khoa học

... insoluble polysaccharide, and thus possesses a true chitin-binding ability In vitro inhibition of < /b> CaCO3 precipitation with N63 The < /b> effect of < /b> nacre ASM and purified N63 on the < /b> kinetics of < /b> CaCO3 precipitation ... the < /b> nacre ASM Both samples exhibit characteristic bands of < /b> proteinaceous and ⁄ or glycoproteinaceous components [35]: the < /b> thick bands around 3270 cm)1 are attributed to the < /b> -OH and the < /b> amide A ... groups (N-H bonds), the < /b> two small bands at 2915 and 2850 cm)1 were assigned to the < /b> C- H bonds, and the < /b> two noteworthy bands near 1640 and 1530 cm)1 were ascribed to the < /b> amide I (C= O bond) and the < /b> amide...
  • 14
  • 383
  • 0
Báo cáo khoa học: Isolation and identification of antimicrobial components from the epidermal mucus of Atlantic cod (Gadus morhua) docx

Báo cáo khoa học: Isolation and identification of antimicrobial components from the epidermal mucus of Atlantic cod (Gadus morhua) docx

Báo cáo khoa học

... higher concentration of < /b> NaCl In contrast to both B megaterium and C albicans, the < /b> inhibition of < /b> the < /b> extract against E coli was increased with increased concentration of < /b> NaCl showing maximum inhibition ... of < /b> Iceland and 50 specimens were caught randomly After killing the < /b> fish by a concussion of < /b> the < /b> brain by striking of < /b> the < /b> cranium, mucus samples were collected by scraping the < /b> skin and then were ... explained by the < /b> cations interfering with the < /b> electrostatic interaction of < /b> the < /b> positively charged components found in the < /b> mucus and the < /b> negatively charged microbial surface The < /b> fact that mucus components...
  • 10
  • 391
  • 0
Extracted from the 17th edition of Which MBA? docx

Extracted from the 17th edition of Which MBA? docx

Cao đẳng - Đại học

... use the < /b> degree, to allow a functional specialist to become a general manager) Elective courses can produce specialists, but they will be specialists who can understand the < /b> other functions of < /b> management ... in Brussels; and the < /b> UK’s Association of < /b> MBAs (AMBA) These are the < /b> bodies listed in the < /b> school profiles in the < /b> directory section Most business schools listed are accredited by one or more of < /b> these ... that the < /b> school of < /b> their choice is accredited by at least one body 44 Which MBA? © The < /b> Economist Intelligence Unit Limited 2005 Extracted from < /b> the < /b> 17th edition of < /b> Which MBA? Full-time MBAs The...
  • 57
  • 271
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "The Derivation of a GrammaticaUy Indexed Lexicon from the Longman Dictionary of Contemporary English" pptx

Báo cáo khoa học

... predictable on the < /b> basis of < /b> the < /b> word grammar rules and need not be independently specified for each entry On the < /b> other hand, the < /b> values of < /b> SUBCAT and LAT are not predictable from < /b> either part of < /b> speech ... to make the < /b> on-llne production of < /b> the < /b> syntactic component of < /b> lexical entries both viable and labour saving However, the < /b> less than 100% accuracy of < /b> the < /b> code assignments in the < /b> source dictionary ... associated with a set of < /b> frames Exercising the < /b> first option causes all instances of < /b> the < /b> surface form and associated syntactic frames to be removed from < /b> the < /b> screen and from < /b> further consideration by...
  • 8
  • 353
  • 0

Xem thêm

Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008