... subtypes based onthe antigenic variation of the hemagglutinin (HA) and neuraminidase (NA) surface glycoproteins Influenza A are spherical or filamentous in shape, with the spherical forms ranging from ... which consists of an N-terminal PYD domain and a C-terminal caspase activation and recruitment domain (CARD) that is necessary for the binding of caspase-1 tothe inflammasome (Martinon and Tschopp ... function upstream of the effector caspases in apoptosis and are known as initiator caspases A phylogenetically distinct group of 13 caspases (caspase-1, caspase-4, caspase-5, caspase-11 and caspase-12)...
... combines the available cores from an initial transperineal biopsy with those that could be available for a transperineal rebiopsy; call this total number of cores Nt Thus, one can plan in advance ... detection area, S2, for one point core in terms of a tumor radius, DT/2 The PoD is calculated fromthe ratio of that part of the core's detection area (2 A1 + Asec) that actually overlaps with the ... Competing interests The authors declare that they have no competing interests Authors' contributions Both authors made contributions to each aspect of the paper Both authors have read and approved the...
... CTTTGTTATTTATTATGCATTCCTATGGTGAGTT AACTCACCATAGGAATGCATAATAAATAACAAAG CTTTGTTAAAGCTTATGCATTCCTATGGTGAGTT AACTCACCATAGGAATGCATAAGCTTTAACAAAG CCTCTTACACTTGCTTTTGAC GCAAAGGTGCCTTTGAGGTTG GACCCCTTCATTGACCTCAACTA ... TACGAGATCTGTTGTTTGGAAGCAGGTT CGGAAGATCTGGGATCATGCCCATTTAG TACGAGATCTTAGCTACATTAAATAGGC GGGATCATGCCCAAGCTTATTTTCCTTACT AGTAAGGAAAATAAGCTTGGGCATGATCCC GCTCACTGCCTAAGCTTTGTAGCTAATAAAG CTTTATTAGCTACAAAGCTTAGGCAGTGAGC ... domain either 5¢ or 3¢ tothe core domain resulted ina similar deadenylation and overall mRNA decay rate [33] The PAI-2 ARE is unusual in that in addition to an auxiliary domain (Fig 7, the atypical...
... factor for a disease or you can have many The more risk factors you have, the more likely you are to get the disease One doctor has suggested thinking of multiple risk factors for a disease in ... usually done right away if coronary angiography shows problems in blood flow ina coronary artery A thin tube with a balloon at one end is threaded into a coronary artery that has narrowed because ... U.S Administration on Aging U.S Environmental Protection Agency National Institutes of Health National Cancer Institute; National Center for Complementary and Alternative Medicine; National Heart,...
... Climate Change Indicator Ozone Depletion Indicator Acidification Indicator Eutrophication Indicator Toxics Dispersion Indicator Solid Waste Disposal Indicator Composite Pollution Indicator Resource ... Planning and Development Collaboration International and the World Conservation Monitoring Centre, African Data Sampler: An Internationally Comparable Map and Georeferenced Data Base (WRI, Washington, ... tell what is happening tothe environment As a practical matter, data to construct indicators is usually most available for pressure indicators and sparsest for response indicators For practicality's...
... Traditional meetings and ofÞce time will need to be factored into most virtual working arrangements !Beware new mountains of information Already awash in data, vast new stores of information will ... are about to be developed Traditional methods of managing and analysing these kinds of data have been inadequate, according to Thornton May, futurist and dean of the US-based IT Leadership Academy: ... your organisation “Organisations need to open up their workload,” says Mr May of the IT Leadership Academy “People like working on information—they are prepared to give their time away for free on...
... Accounting Incorporated, Kessler International, sequence incorporated, Gottschalk forensic accounting and valuation Inc., LBC international investigative accounting inc etc The practice is just gaining ... Examination for discovering, including the formulation of the act regarding the financial residence Attendance at the examination for discovery to review the testimony, assist with understanding the ... With the private sector, there are corrupt practices either by the staff within the companies in form of white-collar fraud or groups of consortium either as consultant, contractors or sub-contractors...
... HA and NA (A) Seasonal amino acid next (A) Seasonal amino acid distances of H3N2 HA and NA proteins since 1999 and (B) amino acid distances of H3N2 HA and NA from one season tothe next The same ... human nasal swab suspensions or nasopharyngeal aspirates positive for influenza A, from 1999 to 2006, were available at the WHO National Influenza Centre, Copenhagen The seasonal distribution was ... following 2003–2004 season and none have been sampled since in Denmark Variations inthe haemagglutinins Variation among H3N2 viruses The amino acid positions in H3N2 HA that have become fixed after...
... 2 Allergy, Asthma, and Clinical Immunology / Volume 2, Number 1, Spring 2006 References DOI 10.2310/7480.2006.00005 Minegishi Y, Lavoie A, Cunningham-Rundles C, et al Mutations in AID in patients ... AID in patients with hyper IgM syndrome Clin Immunol 2000;97:203–10 Zhu Y, Nonoyama S, Morio T, et al Type two hyper-IgM syndrome caused by mutation in ...
... planning format into a MATLAB cell-array data object, facilitating manipulation; (2) viewers which display axial, coronal, and sagittal computed tomography images, structure contours, digital ... radiation dose escalation beyond the conventional 50 Gy, possibly with concurrent chemotherapy, remain reasonable in inoperable pancreatic cancer As issues relating to pancreatic motion are addressed, ... in individual patients Specifically, inthe patient with the largest interfraction variation, the fractional volume of small bowel irradiated to at least 40 Gy ranged from 1% to 20% Inthe patient...
... Clinical assessment The clinical evaluation of each patient was rated according tothe Positive and Negative Symptom Scale (PANSS) [31,32] and tothe Hamilton Rating Scale for Depression Selva-Vera ... Fluency (FAS Test fromthe Controlled Oral Word Association Test and the Category Instant Generation Test [CIG]) 8) Motor Speed (Finger-Tapping Test in unimanual and bimanual conditions) The variable ... interpretation of data, the writing of the report, orinthe decision to submit the paper for publication Dr Vieta has received grants fromor acted as a consultant for the following companies: AstraZeneca,...
... design and coordination and drafted the manuscript RB carried out the field work, assisted in data analysis and assisted in drafting the manuscript All authors read and approved the final manuscript ... female or child, robbery and arson, based onthe criteria of Bailey and MacCulloch [22] Data analysis Data were analyzed using the Statistical Package for Social Sciences SPSS for Windows (version ... were male and 57 (79%) were Caucasians The remainder were of AfroCaribbean (10%) or Asian/mixed race origin (11%) Clinical case files, which record multi-axial diagnoses, indicated that the majority...
... made it clear that their organization did not want to break the law in any way and agreed to cease operating a fixed needle exchange at the corner until such a time that the permit was obtained ... person in need In analogy, this approach is similar toa religious organization providing food tothe starving but insisting on some participation in religious activities in order to obtain the ... Hotel as part of the organization's ongoing syringe distribution and retrieval services The WND was born Early indicators of the need to move from exchange to distribution Critical examinations...
... contains > 24,000 well annotated RefSeq transcripts and allows samples to be interrogated in parallel To minimize array to array variability, a cRNA sample from each of the sham, GMA-MS and GMA-SS ... correction precedes the variance stabilizing transformation (VST) method which takes advantage of the technical replicates available on an Illumina microarray Data normalization proceeds using the ... coupregulation at 16 weeks inthe B6 strain intriguing [29] The dysregulation of the calgranulins S10 0A8 and A9 , in addition to CCL2 and IL8Rβ, warrants further investigation into a possible delayed inflammatory,...
... Non-modifiable risk factors include: female gender, Caucasian or Asian race, family history [2] and a personal history of fracture as an adult Modifiable factors include: smoking, inadequate dietary calcium, ... clinical data and coordinated general edits and preparation of the final manuscript All authors read and approved the final manuscript Page of 11 (page number not for citation purposes) Theoretical ... receiving suppressive LT4 therapy It is desired to find the value of BMD as a function of the duration and the dose of LT4 therapy Any remaining factor can be regarded as a special case of a variable...
... DD 2A AAGAGGAAAGCCCGGAAGAAGGGAG G A •••••••••••GG•••••AC• G••G•••••••AAAA••AC••AAC• G A ••••••••• AA G••AC• GGA• A G•• A AAG A •••AC• G•• A G•• A •••G A •••AC• G 36 Figure Familial relationships ... Discussion The aim of this study was to refine the position of a previously mapped QTL by increasing the marker density inthe region, target sampling of additional families and adapting fine mapping ... TGGAACCAGTGAAGTTTAGGG GAAATGCCCACTGAAGCTCT Set3 ETH2 112.43 112903902-112909263 ATTTGCCCTGCTAGCTTTGA AAGACTCTGGGCTTCAAAAGG Set1 DIK2122 114.68 113216193-113216706 CAACAAACTGTGCGTTGTGA ACTCAGCAGTTGCCCTCAGT...
... such as linearity and dominance However, transformational grammar was “criticized by Relational Grammarians who emphasize the importance of taking grammatical relations into consideration” (Shibatani, ... meaning and /or pragmatic and syntax or linguistic forms What they have done can only be considered as a description of the surface or external part of the language What they fail to is to search ... (Antovic, 2003, c.f Langacker 1987) although words have conventional meanings associated with them In order to understand the meaning of an individual word, apart fromthe conventional meaning...