check when replacing with a cd that can be played normally without any scratches or soiling
PERFECT PRESENTATIONS Presenting with impact is a skill that can be learned by anyone
Ngày tải lên :
27/06/2016, 10:30
... Public Speaking • Many dread it • Basic skills can be learned to get message across • With application and good training anyone can be a fluent and confident speaker • A great asset you will use ... without any formal training, • And without getting accurate feedback Supporting Materials • Slide-shows not the heart of the presenation • For backup, not a script Training in presentation skills ... your career Presentation • • • • To get across the message, To inform, To explain, and To train • A powerful way – Presentation: An assumed skill • A skill managers expectd to have acquired without...
- 23
- 393
- 0
built to sell creating a business that can thrive without you john warrillow
Ngày tải lên :
11/06/2014, 12:10
... into a chairman’s role, which is a kind of quasi-exit Or so that you can stay involved day to day and work on building an enduring company that can go on without you The point is that the best ... Network, Bob Lapointe at Inc magazine, Shane Lawrence at TD, Randy McCollum at Administaff, Kyle McNamara and Dave Wilton at Scotiabank, Jeff Parker at US Bank, Bruno Perreault at MasterCard, ... imagine that you’ll ever want to leave the company you worked so hard to build, there are many reasons for wanting to build a sellable business: Your company may be your best shot at a comfortable...
- 104
- 816
- 5
quiet the power of introverts in a world that can t stop talking
Ngày tải lên :
27/12/2017, 10:54
... of Random House, Inc The BIS/BAS Scales on this page–this page copyright © 1994 by the American Psychological Association Adapted with permission From “Behavioral Inhibition, Behavioral Activation, ... change the course of American history I had always imagined Rosa Parks as a stately woman with a bold temperament, someone who could easily stand up to a busload of glowering passengers But when ... liberal and conservative—humanity would be unrecognizable, and vastly diminished, without both personality styles Take the partnership of Rosa Parks and Martin Luther King Jr.: a formidable orator...
- 1.1K
- 258
- 0
Tài liệu Write Data Validation Code That Can Be Reused in Other Classes docx
Ngày tải lên :
24/12/2013, 06:17
... be used as a base class 13 Declare the two class-level variables: cValidChars and mstrValue Note that both variables are declared as protected This means that the variables will only be accessible ... small, reusable code Any other class that represents a table containing a CustomerID can utilize the CCustomerID class and is guaranteed to always have a valid value whose existence in the database ... regular class, an abstract class does contain some implemented methods and properties, and even though it cannot be instantiated, it can have constructors Table 9.3 Visual Basic NET Class Inheritance...
- 16
- 360
- 0
Monkey with a PinWhy you may be missing 6% a year on your investment returns pot
Ngày tải lên :
27/06/2014, 23:20
... accounts after a short-term bonus rate has expired Data from accounts that no-one uses anymore For building society data, Barclays originally used the average interest rate on an ordinary share ... for basic rate taxpayers.3 This makes obtaining a better-than-inflation return more difficult Having said that, the author’s own analysis of interest rates over the last 20 years shows that an ... last 112 years5 shows that equities have returned nearly 5% a year above that of the rate of inflation In contrast, holding cash has beaten inflation by only around 1% Take care with that word...
- 110
- 386
- 0
Báo cáo y học: "Frozen Elephant Trunk: A technique which can be offered in complex pathology to fix the whole aorta in one setting" pps
Ngày tải lên :
10/08/2014, 09:21
... Postoperative images of the aorta (a. ) 3D CT reconstruction image of the thoracic aorta showing complete replacement of ascending aorta and aortic arch, the FET in the descending thoracic aorta and ... ascending aorta Debranching of the supra-aortic vessels, followed by immediate antegrade or retrograde stent-grafting of the aortic arch and descending aorta was unsuitable for our patient due to aneurysmal ... relaxant Invasive monitoring included the use of right radial and left radial arterial lines, a pulmonary artery catheter and a foley catheter with temperature probe to measure bladder temperature...
- 5
- 571
- 0
windows xp services that can be disabled
Ngày tải lên :
19/10/2014, 09:30
... doanh bên tham gia doanh nghiệp liên doanh Vốn góp liên doanh tiền mặt vật vật tư, hàng hoá theo thoả thuận bên liên doanh - Nguồn vốn vay: vốn vay ngân hàng thương mại tổ chức tín dụng, vốn vay ... hình thái ban đầu tiền tệ sang hình thái vật tư hàng hố cuối quay trở lại hình thái tiền tệ ban đầu gọi tuần hoàn vốn lưu động Cụ thể tuần hoàn vốn lưu động chia thành giai đoạn sau: - Giai đoạn ... kinh doanh trình kết hợp yếu tố để tạo sản phẩm hàng hoá, dịch vụ Khác với tư liệu lao động, đối tượng lao động tham gia vào trình sản xuất kinh doanh ln thay đổi hình thái vật chất ban đầu,...
- 13
- 516
- 0
BÀI LUẬN TIẾNG ANH HAY write a story that ends with i am amazed at what people can achieve when they are forced to
Ngày tải lên :
16/08/2015, 23:52
... BÀI LUẬN TIẾNG ANH HAY THEO CHỦ ĐỀ ...
- 2
- 859
- 1
How to setup a Linux system that can boot directly from a software RAID
Ngày tải lên :
18/09/2012, 10:11
... replace the failed one is available it can be installed into the system, partitioned to have the two software RAID partitions to replace the ones of the failed drive The new partitions can be added ... Documentation License This document is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE ... disks already contains data, make a backup if needed (all existing data of partitions involved in the process will be lost), and delete or resize existing partitions to create space for the software...
- 14
- 567
- 1
two-word phrasal verbs that require an additional particle when used with an object, 1
Ngày tải lên :
01/11/2013, 15:20
... officials as a reward for giving you business is a kickback The FBI agent heard the governor asking for a kickback The reporter discovered that the loan was really a kickback kick back p.v [informal] ... tell someone to go ahead with an action, you give permission for that action What are you waiting for? Go ahead Yes, go ahead and leave work early It's no problem go-ahead n When you give people ... If I work up some energy, I'll wash the car I really worked up a sweat in the gym today Raking leaves all day sure works up an appetite worked up part.adj [informal] When you are anxious, worried,...
- 17
- 684
- 2
two-word phrasal verbs with the particle in that require into when used with an object
Ngày tải lên :
01/11/2013, 16:20
... compartment, you check it in 315 That bag is too big for carry-on — you'll have to check it in checked in part.adj Luggage that has been checked in or passengers that have checked in are checked ... Instead, get has a meaning similar to become or change to: I got up at 6:00.{\ was not up before, and then I became up — I changed from not being up to being up.) Many phrasal verbs with get that ... learn faster or get more work done because you are learning or working more slowly than the others, you get behind or get behind in your studies or work When you not complete work as fast as originally...
- 17
- 633
- 0
Báo cáo khoa học: The effect of replacing the axial methionine ligand with a lysine residue in cytochrome c-550 from Paracoccus versutus assessed by X-ray crystallography and unfolding ppt
Ngày tải lên :
07/03/2014, 17:20
... potential cannot easily be made The heme group in the wt and M100K structures deviates from planarity and can be described as saddle shaped Such a feature appears common to all cyts c, regardless ... synchrotron radiation facilities and we would like to thank Dr P Carpentier for assistance in using beamline BM3 0a References Katayama Y, Hiraishi A & Kuraishi H (1995) Paracoccus thiocyanatus a new ... cryo-cooled M100K crystals, data was obtained at the European Synchotron Radiation Facility at beamline BM3 0a using a MARCCD detector A suitable cryoprotectant was found consisting of a 20 : 10 (v ⁄...
- 15
- 509
- 0
Báo cáo khoa học: Purification of a plant nucleotide pyrophosphatase as a protein that interferes with nitrate reductase and glutamine synthetase assays pdf
Ngày tải lên :
08/03/2014, 08:20
... inhibitor in a 100-lL incubation at 30 °C for 10 min, using the amounts and concentrations of ATP and NADH used in standard GS and NR assays, respectively Data are presented as mean ± SEM Cofactor AMP ... and comparing with a standard curve For routine assays of NR inhibitor, NR was partially purified by ammonium sulfate fractionation (0–30%) of a spinach leaf crude extract prepared as described in ... control with no enzyme, which was run parallel to each assay The assays which contained ATP in stage I were diluted 100-fold for stage II All assays were performed at least in duplicate NADH oxidase...
- 7
- 457
- 0
Báo cáo khoa học: Identification of preferred substrate sequences for transglutaminase 1 – development of a novel peptide that can efficiently detect cross-linking enzyme activity in the skin pot
Ngày tải lên :
23/03/2014, 06:20
... sequences for TGase [3H]-putrescine incorporated (×104 dpm) × Y Sugimura et al TGase TGase TGase Factor XIIIa 1.4 Relative value 1.2 0.8 0.6 0.4 0.2 WT – 2A – 1A QN + 1A + 2A + 3A + 4A + 5A + 6A + 7A + 8A + 9A Fig ... Yamashita F, Ishida-Yamamoto A, Yamada K, Kinoshita C, Fushiki S, Ueda E, Morishima Y, Tabata K, Yasuno H et al (1998) Defective stratum corneum and early neonatal death in mice lacking the gene for ... Yoshimura (Graduate School of Bioagricultural Sciences, Nagoya University, Japan) for technical advice on analysis of the tissue sections, and Dr H Shibata of our laboratory for his valuable suggestions...
- 11
- 449
- 1
Analyse criterias when there is an m and a and take a company that you know as an example to analyse your criterias analyses
Ngày tải lên :
08/05/2014, 17:42
... areas • Ongoing share growth and the synergies across marketing, branding, and advertising Nokia • Be the best path forward for Nokia and shareholders • Be future opportunities for many Nokia ... call and free •Xbox phonelead the camara but also will always lead in the mobile entertainment industry Growth •Nokia Lumia surface two companies will be more peaks than if we become one • Smasupport ... headquarters in Finland for 170 Microsoft Corporation is an American multinational corporation million euros headquartered in Redmond , Washington Growth •Development skype •Renowned for quality...
- 17
- 724
- 8
what can you do with a major in biology real people, real jobs, real rewards (what can you do with a major in...)
Ngày tải lên :
01/06/2014, 10:54
... highly ranked college that is large, was that a good choice for you? Maybe not Just because a college is ranked high one year—just before you start your freshman year—is there any guarantee that by ... limitation warranties of fitness for a particular purpose No warranty may be created or extended by sales or promotional materials The advice and strategies contained herein may not be suitable for ... this work as a citation and /or a potential source of further information does not mean that the author or the publisher endorses the information the organization or Website may provide or recommendations...
- 142
- 375
- 0
Báo cáo hóa học: " Boosting high-intensity focused ultrasoundinduced anti-tumor immunity using a sparse-scan strategy that can more effectively promote dendritic cell maturation" ppt
Ngày tải lên :
18/06/2014, 16:20
... is advantageous in treating patients with unresectable cancers, such as pancreatic carcinoma, or with poor physical condition for surgery Unlike radiation and chemotherapy, HIFU can be applied ... HIFU can be applied to most internal organs with an appropriate acoustic window for ultrasound transmission except those with air-filled viscera such as lung or bowel In particular, HIFU is advantageous ... hypothesize a sparse-scan strategy that can produce separated thermal lesions and reserve surrounding peripheral tumor tissue may provide more stimuli for DC maturation than currently used dense-scan...
- 12
- 345
- 0
Báo cáo sinh học: " Panicovirus accumulation is governed by two membrane-associated proteins with a newly identified conserved motif that contributes to pathogenicity" pptx
Ngày tải lên :
19/06/2014, 08:20
... CTCCAGACAGCCGCCTGGTTAGC CACACCCTGTAGAGGGCTCTCCAG CCTTTCTTATCAGCCACCCTGTAGAG GGAATACAGCTGGCAAGGC TGATCCTGGGCGTATGCGC GCCCCAACTAATGCATTGGTCACTAG CCAAGCAGTCGCATTGGCCCC a The altered nucleotides on the PMV cDNA are ... blotted, and probed for PMV accumulation with a 32Plabelled cDNA that detects genomic (g) and subgenomic (sg) RNA Proteins were separated via SDS-PAGE and probed with rabbit polyclonal antiserum against ... plants CD mutations not affect RNA cis-elements Many RNA viruses contain RNA cis-elements that can affect replication To test if amino acid changes (F31 3A, F35 7A, and W405) may have inactivated...
- 12
- 307
- 0
Báo cáo khoa học: "Choosing simplified mixed models for simulations when data have a complex hierarchical organization. An example with some basic properties in Sessile oak wood (Quercus petraea Liebl.)" ppsx
Ngày tải lên :
08/08/2014, 14:20
... colour, spiral grain, multiseriate wood rays) on both standard small-size samples and industrial-size boards Our data have a hierarchical organization Each level of the hierarchy could be a level ... climates: north of Alsace (sandstone hills and sandy-loamy soils in the plain), Plateau lorrain, Val de Loire, Basse-Normandie, Allier-Bourbonnais (Center of France) In each region, a large range ... Lorraine Poor Loir-et-Cher Allier Medium Lorraine Hight forest Alsace Loir-et-Cher Lorraine Normandy Allier 2 Loir-et-Cher 1 Lorraine mod 3 Normandy modalities Loir-et-Cher Allier Poor Normandy...
- 9
- 304
- 0