chc 5 combination of a mixer a cross flow combustor heat exchanger and a heat exchanger for product quenching for hydrogen oxidation
Báo cáo hóa học: " Closing two doors of viral entry: Intramolecular combination of a coreceptor- and fusion inhibitor of HIV-1" docx
... NNTTWEAWDRAIAEYAARIEALIRAAQEQQEKNEAALREL B performed BFFI and CCR5mAb had very similar binding affinity to human CCR5, suggesting that addition of the FI did not alter the binding affinity of the ... NL-Bal C Reduced antiviral activity of BFFI against a partially T26 35- resistant virus The antiviral activity of BFFI (squares) and T-26 35 (circles) against wt (filled symbols) and the partially ... that the variable region of the CCR5mAb in BFFI contributes to the antiviral activity Figure Design and biochemical characterization of BFFI Design and biochemical characterization of BFFI A...
- 10
- 341
- 0
Tài liệu Báo cáo " synthesis, cloning and expression in escherichia coli of a gene coding for Mcoti-ii " ppt
... gagcaataac 320 321 tagcataccc 361 TTTTTGCTGA cttggggcct AAGGAGGAAC ctaaacgggt TATATCCGGA cttgaggggt TATCCCGCAA 360 400 401 GAGCCCGGCA GTACCGGCAT AACCAAGCCT ATGCCTACAG 440 441 CATCCAGGGT TTG GACGGTGCCG ... gaaaaaatgc cgccgcgata gcgattgccc gggcgcgtca 200 201 tttgccgcgg caacggctat tgcggctaac tcgagcccgg 240 241 gtgactgcag gaaggggatc cggctgctaa caaagcccga 280 281 aaggaagctg agttggctgc tgccaccgct gagcaataac ... primers for MCoTI-II gene cttaaggtatactcgccgtcgcgtaccgccgcacacgggcttt gaattccatatgagcggcagcgatggcggcgtgtgcccgaaa M S G S D G G V C P K taagacttttttacggcggcgctatcgctaacgggcccgcgc attctgaaaaaatgccgccgcgatagcgattgcccgggcgcg...
- 9
- 497
- 0
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf
... GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA1R, 5 -TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5 -CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5 -GAATTCATTATGTTTCAGGTTCA GGGG-3¢ for the latter The PCR products were cloned ... SV40T Ag and the 3¢ portion of the tsA58T Ag cDNA carrying the A4 38V mutation were PCR-amplified from COS-7 cDNAs using the following primers: LTA-1F, 5 -CTC GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA1R, ... Dong QG, Bernasconi S, Lostaglio S, De Calmanovici RW, Martin-Padura I, Breviario F, Garlanda C, Ramponi S, Mantovani A & Vecchi A (1997) A general strategy for isolation of endothelial cells from...
- 11
- 873
- 0
Báo cáo "Development of a software package for 3D structured mesh generation " pdf
... inverse mapping between the 3D real computational domain and a rectangular domain in the parametric space [1, 2, 5, 6] For short, the formulae for Y and Z coordinates are the same and they are not ... computational meshes obtained is acceptable These generated meshes have been used as the input of a 3D computational fluid dynamics software for turbulent compressible atmospheric flows and air quality ... simulations 4.1 The graphic user interface of the package The package is designed with a main interface that allows users to input topographical elevation data of the top (upper) surface of any...
- 14
- 402
- 0
Báo cáo khoa học: "Automatic Induction of a CCG Grammar for Turkish" pptx
... an adjunct extraction ( 9a) and an object extraction (9b) A T.LOCATIVE.ADJUNCT dependency link is added from araba to uyudu um g to emphasize that the predicate is intransitive and it may have a ... grammars In Language and Information ed Bar-Hillel, AddisonWesley, pages 991 15 Yehoshua Bar-Hillel 1 953 A quasi-arithmetic description for syntactic description Language, 29:4 758 Cem Bozs ahin ... Michael Collins 1999 Head-driven Statistical Models for Natural Language Parsing Ph.D thesis, University of Pennsylvania Julia Hockenmaier 2003 Data Models for statistical parsing with Combinatory...
- 6
- 373
- 0
Báo cáo khoa học: "PEAS, the first instantiation of a comparative framework for evaluating parsers of French" potx
... the automatic fusion of all annotated data of the parsers, and then manually correct the divergent parses.' Last of all, the XML format into which we translate the parses is an open exchange format ... the address of its parameters Of course, all of them are not to be filled in All the information thus annotated is then translated into an XML format Annotation of the example of §2 is translated ... Natural Language Workshop, pages 306-311, Pacific Grove, California, February, Morgan Kaufmann R Gaizauskas, M Hepple and H Huyck 1998 A scheme for comparative evaluation of diverse parsing systems...
- 4
- 323
- 0
Báo cáo khoa học: Inhibition of a-synuclein fibrillization by dopamine analogs via reaction with the amino groups of a-synuclein Implication for dopaminergic neurodegeneration pot
... analogs with a- Syn and some amino acids (A) UV-vis spectra of a- Syn with DA, CA, HQ and Q after reaction for 24 h The a- Syn alone sample was as a control The concentration of a- Syn was 200 lM and ... 1H-15N HSQC spectra of the reactions of a- Syn with quinone and DA (A) Overlay of the 1H-15N HSQC spectra of a- Syn (black) and the reaction product of a- Syn and Q (red) (B) Overlay of the 1H-15N ... assay The concentration of a- Syn was 200 lM and the fibrillization of a- Syn alone was as a comparison Data were represented as means ± SEM (F) Atomic force microscopic images of a- Syn fibrils a- Syn...
- 12
- 414
- 0
Báo cáo khoa học: "The Design of a Computer Language for Linguistic Information" ppt
... rules that are shared among lexical items, as well as by the declarative nature of the grammar formalism itself, 6The example is merely meant to be indicative of the syntax for and operation of lexical ... decidability of that f{,rmalism [Kaplan and Bresnan, 83] Off-line parsability req.ires that the context-free "skeleton" of the grammar allows no trivial cyclic derivations of the form A ~ A 2.3 Mathematical ... syntactic, and semantic information, and one operation unification on this representation By way of example, we present a trivial grammar for a fragment of English with a lexicon associating words...
- 5
- 383
- 0
Evaluation of a diagnostic algorithm for smear-negative pulmonary tuberculosis in HIV-infected adults doc
... Table I Baseline data for the 58 smear-negative patients (continued) Characteristic Adenopathy Infiltrate and adenopathy Pleural effusion/thickening and infiltrates Pleural effusion and adenopathy ... culture 55 probable TB cases (3 probable TB cases (3 ‡ had military patterns on had miliary patterns on CXR, and had high ADA CXR, and had high ADA levels in pleural effusion, all levels in pleural ... weight gain after weeks of TB treatment and then defaulted, had died at a secondary hospital weeks later Another patient defaulted TB medication and died weeks later The outcome of the third case...
- 7
- 366
- 0
Báo cáo hóa học: " Development and application of a biomarker assay for determining the pharmacodynamic activity of an antagonist candidate biotherapeutic antibody to IL21R in whole blood" pptx
... that will be required upon hand-off for assay validation SJ, AW, SWA and KA performed the in vitro assays on monkeys treated with Ab-01 and control Ig and analyzed the data, and KA and SA performed ... tool used for data analyses and reviewed statistical analyses YG participated in the assessment and selection of TaqMan PCR assays for studies in monkeys and participated in the biomarker discovery ... this basic approach (ex vivo stimulation of whole blood) to develop pharmacodynamic biomarker assays for a candidate therapeutic antibody, Ab-01 Ab-01, a human antibody generated by phage display,...
- 13
- 528
- 0
Báo cáo hóa học: " Development of a mathematical model for predicting electrically elicited quadriceps femoris muscle forces during isovelocity knee joint motion" potx
... Experimental 400 Figure shortening velocities (a, c, e, and g) and peak forces (b,d), -1 25 /s (e and f), and -200°/s (g and h) jects of force-time integrals of - 25 /s (a and b), - 75 /s (c and d, f, and ... 8c, 8e, and 8g) In contrast, at - 25 /s the model underestimated the peak forces at IPIs of 30 and 50 ms for both the CFTs and VFTs and at IPIs of 50 and 70 ms for the DFTs (Fig 8a) For the force-time ... mean (+ used for validation of the isovelocity model peak forces (a, c, e, and g) and Bar graphs Bar graphs of comparisons between the mean (+ standard error) experimental and predicted peak forces...
- 20
- 466
- 0
báo cáo hóa học: " Rehabilitation robotics: pilot trial of a spatial extension for MIT-Manus" pdf
... operated in standalone fashion or integrated to the planar MIT-MANUS to allow spatial movements Note that in the standalone fashion it can be operated at any angle to the horizontal and vertical ... application of robotics as a therapy aid, and in particular a tool for therapists We foresee robots and computers as supporting and enhancing the productivity of clinicians in their efforts to facilitate ... fashion or integrated to the planar MIT-MANUS to allow spatial movements Note that in the standalone fashion it can be operated at any angle to the horizontal and vertical planes with adjustable...
- 15
- 298
- 0
Báo cáo hóa học: " Strong convergence of a hybrid method for monotone variational inequalities and fixed point problems" ppt
... Lipschitz-continuous variational inequality problem and the set of common fixed points of an infinite family of Yao et al Fixed Point Theory and Applications 2011, 2011 :53 http://www.fixedpointtheoryandapplications.com/content/2011/1 /53 ... literature for solving a more general problem that consists of finding a common point that lies in the solution set of a variational inequality and the set of fixed points of a nonexpansive mapping ... contributions All authors participated in the design of the study and performed the converegnce analysis All authors read and approved the final manuscript Competing interests The authors declare that they...
- 10
- 425
- 0
Báo cáo hóa học: "Setup, efforts and practical experiences of a monitoring program for genetically modified plants - an Austrian case study for oilseed rape and maize" pptx
... http://www.eea europa.eu/data -and- maps/data/eea-reference-grids which is used as the standard reference grid for all spatial statistic data in Austria Hence, we have a direct spatial link between our BINATS ... feral B napus, B nigra, feral B oleracea, wild and feral B rapa, Conringia austriaca, C orientalis, Crambe tatarica, Diplotaxis muralis, D tenuifolia, Eruca sativa, Erucastrum gallicum, E nasturtiifolium, ... types, climatic conditions and management regimes of a country; (2) baseline data necessary for detecting changes in the abundance and diversity of plants and animals as well as in habitat structures...
- 12
- 497
- 0
Báo cáo hóa học: " Application of a MANET Testbed for horizontal and vertical scenarios: performance evaluation using delay and jitter metrics" potx
... packet size, LQWS, and topology setting function We can save the data for these parameters in a text file and can Page of 14 Hiyama et al Human-centric Computing and Information Sciences 2011, ... quartile, and the outliers In the plot, the bottom and top of the box are always 25th and 75th percentile, respectively, and the band near the middle of the box is always the median The end of ... Barolli L, Ikeda M, De Marco G, Durresi A, Xhafa F (2009) Performance Analysis of OLSR and BATMAN Protocols Considering Link Quality Parameter Proc of IEEE AINA-2009 307–314 11 Kulla E, Ikeda...
- 14
- 471
- 0
Báo cáo hóa học: " Research Article Experimental Characterization of a UWB Channel for Body Area Networks" potx
... L= 3 .5 4 .5 Frequency (GHz) 50 Ohms load Antenna at free space Antenna at head Antenna at chest Antenna at thigh Figure 5: Measured return loss of the antenna (b) Non-Line -of- Sight The transmission ... TX and RX antennas placed near the human are characterized The frequency- and distancedependent characteristics of a UWB channel are analyzed in this paper, where an NLOS channel is shown to have ... Communications and Networking Conference (WCNC ’07), pp 24 75 2480, 2007 [6] A Khaleghi, R Ch´ vez-Santiago, and I Balasingham, “Ultraa wideband pulse-based data communications for medical implants,”...
- 11
- 363
- 0
Báo cáo hóa học: "Research Article Evaluation of a Validation Method for MR Imaging-Based Motion Tracking Using Image Simulation" ppt
... to apply deformation to a phantom and provides an independent EURASIP Journal on Advances in Signal Processing measure of deformation allowing validation of MR imagingbased motion and deformation ... validation of a 3D MR imaging-based motion and deformation tracking technique, applicable to 3D deformation, is presented The validation method, based on marker tracking, was evaluated (and validated) ... complex and require validation using an independent measure of deformation Since physically implanting markers is not feasible and anatomic landmarks are either absent or difficult to track, alternative...
- 11
- 344
- 0
Báo cáo hóa học: " Research Article Strong Convergence of a New Iteration for a Finite Family of Accretive Operators" pdf
... Theory and Its Application, Yokohama, Yokohama, Japan, 2000 16 W Takahashi and Y Ueda, “On Reich’s strong convergence theorems for resolvents of accretive operators,” Journal of Mathematical Analysis ... solution of ∈ U x for a maximal monotone operator U in Hilbert space,” Journal of Mathematical Analysis and Applications, vol 48, pp 114–126, 1974 L.-C Ceng, A R Khan, Q H Ansari, and J.-C Yao, “Strong ... solutions of a finite family of accretive operators,” Nonlinear Analysis: Theory, Methods & Applications, vol 70, no 6, pp 2344–2 351 , 2009 S Kamimura and W Takahashi, “Approximating solutions of maximal...
- 15
- 296
- 0
Báo cáo hóa học: "Research Article Microarchitecture of a MultiCore SoC for Data Analysis of a Lab-on-Chip Microarra" docx
... multithousands of spots microarrays producing vast amount of data and evaluate the final results for molecular diagnostics examinations Targeted application areas are mutation detection for gene ... PROCESSING ALGORITHM Statistical analysis of microarray data can essentially process massive amounts of data and can also adjust for various sources of variability in order to identify the important ... two alternative architectures of the single-core and multicore approach Also, the details for the data analysis of the microarray of a custom Lab-on-Chip are described 4.1 Microarray data analysis...
- 11
- 614
- 0
Báo cáo hóa học: " Research Article On Definition of a Formal Model for IEC 61499 Function Blocks" pdf
... and associated data buffer; (iv) for each data output of a composite block, there is a data buffer; (v) no variables are introduced for data inputs and outputs of subapplications; (vi) each constant ... respectively A data valve is a functional element having one input and one output events and more than zero data inputs and outputs The number of data inputs has to be equal to that of data outputs ... variable; (ii) for each data input of basic or composite FB, there is a variable of the corresponding type; (iii) for each data output of a basic function block, there is an output variable and...
- 10
- 289
- 0
Tìm thêm: xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25