characterization of microorganisms by pyrolysis gc pyrolysis gc ms and pyrolysis ms
Tài liệu Báo cáo khoa học: Characterization of electrogenic bromosulfophthalein transport in carnation petal microsomes and its inhibition by antibodies against bilitranslocase docx
... bilirubin and nicotinic acid reduce the rate of BSP uptake inhibition by antibody A, an effect depending on the formation of a complex between the carrier and the ligands [39] The occurrence of this ... where kA and k0 are the inactivation rate constants either in the presence or in the absence of various concentrations of a ligand A, k2 and k1 are the rate constants of the inhibition of the bilitranslocase– ... detailed in the text and in Fig 5B n, Number of [A] tested; k2 ⁄ k1, the value of the intercept in the Scrutton and Utter plot, where k2 and k1 are the rate constants of the inhibition of either the...
- 15
- 589
- 0
Báo cáo khoa học: Characterization of testis-specific serine–threonine kinase 3 and its activation by phosphoinositide-dependent kinase-1-dependent signalling doc
... and Thr168 located within a T-loop play a significant role in the regulation of TSSK3 activity and suggest a similar mechanism of activation to that of the AGC kinase family For a number of AGC ... control of phosphorylation Middle: bands of phosphorylated MBP by TSSK3 mutants were excised from gel and their radioactivity was measured by scintillation counting Data are representative of three ... latter is of special interest in view of a recent publication on the identification of a testis and brain specific isoform of mouse PDK1, mPDK-1b [29], in which the authors suggest that this isoform...
- 14
- 374
- 0
Tài liệu Báo cáo khoa học: Molecular characterization of Arabidopsis thaliana PUF proteins – binding specificity and target candidates doc
... NRE(A+B)); and in both Box A and B, NRE(A–B–) (C) Qualitative analysis of LacZ reporter activation in the interaction of APUM-2 and APUM-7 with NRE WT and NRE mutants The iron responsive element RNA and ... bound by APUM-2 (A) Scheme of the three-hybrid strategy used in the screen (B) Number of colonies identified in each step of the screen (C) Distribution of the 63 distinct sequences in relation of ... Ribosomal protein; unknown function ugcgucugacaUGUACAGCcccugccaaauuuuaauaggcaat AGUAAAUAaauaacgacaagaagcaaaugg cucaucucuccuuacaguuuaccuguguaggaguuaggguucuuga auaaacaaugcaacaaagauuguagaagucagUGUACAUA...
- 15
- 586
- 0
Tài liệu Báo cáo khoa học: Biochemical characterization of Bacillus subtilis type II isopentenyl diphosphate isomerase, and phylogenetic distribution of isoprenoid biosynthesis pathways doc
... template and the oligonucleotides 5¢-TTGGTGGGATCCGTGACTCG AGCAGAACGAAAAAGAC-3¢ and 5¢-GGCTTTGTCG ACTTATCGCACACTATAGCTTGATG-3¢ as primers (restriction sites are underlined and start- and stop-codons ... accompanied by the appearance of three new 13C-coupled signals at 143.4, 111.3 and 21.4 p.p.m assigned as the carbon atoms 3, 4, and of IPP, respectively (cf Table and Fig 6) Within the limits of experimental ... catalysed by the recombinant enzyme could be monitored conveniently by NMR spectroscopy (Table 1) The 1H NMR and 13C NMR signals of IPP and DMAPP have been assigned previously on the basis of 1H13C and...
- 12
- 692
- 0
Báo cáo khoa học: Biochemical characterization of USP7 reveals post-translational modification sites and structural requirements for substrate processing and subcellular localization pptx
... view of USP7 shown below by acetylation, as confirmed by MALDI-TOF -MS LC -MS analysis of USP7-FL revealed two protein masses of 130 464.0 and 130 540.0 Da, corresponding very likely to acetylated and ... Ub-K-peptide-TAMRA Processing of ubiquitin synthetic substrates by USP7-FL and domain deletion variants Evaluation of the hydrolysis of Ub-AMC and Ub-KTAMRA by USP7-FL and its domain deletion FEBS ... proteolysis of USP7 variants in the presence and absence of ubiquitin SDS ⁄ PAGE (4–20% gradient gels) showing the limited proteolysis of native USP7-FL and variants thereof by trypsin over time with and...
- 15
- 592
- 0
Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot
... CLAP_1:TTGAATGCTGTCACCACTGAGCCAGAAGCTAAGCTAGAACATGCTGCTATCCCTATCAAAGATGGTGAGGCAAAAAACCTTGTGGATCTTGCAGAGTCTC CLAP_2:TTGAATGCTGTCACCACTGAGCCAGAAGCTAAGCTAGAACATGCTGCTATCCCTATCAAAGATGGTGAGGCAAAAAACCTTGTGGATCTTGCAGAGTCTC ... CLAP_1:TCCAGTTTTTTCTGATCTTGTGGAGCTCATTGATAGAGCAGGTCTTGATGAAGCTCTTCAAACCCATGGACCTATTACTTTCTTTGCCCCAAGCAATGAT CLAP_2:TCCAGTTTTTTCTGATCTTGTGGAGCTCATTGATAAAGCAGGTCTTGATGAAGCTCTTCAAACCCATGGACCTATTACTTTCTTTGCCCCAAGCAATGAT ... Resistance of CLAP to degradation by Artemia cathepsin L monomer Fig Activity of the monomeric and dimeric forms of Artemia embryo cathepsin L at different pH and temperatures (A) CLP (dimer) and CL...
- 12
- 772
- 0
Báo cáo khoa học: Characterization of a eukaryotic type serine/threonine protein kinase and protein phosphatase of Streptococcus pneumoniae and identification of kinase substrates doc
... 5’-GGACTGACATATGGAAATTTCATTA-3’ 5’-CTTGCGAATTCGGATCATTCTGCATCC-3’ 5’-CTCGATAGTGCCGGCTTGACC-3’ 5’-GCAGGAGGCCTAGCCAACATT-3’ 5’-GAACTGACATATGGGTAAATATTTTGGG-3’ 5’-CCGCTCGAGTTAGTCAATCCCAATTTCAGC-3’ 5’-CGCGAATTCCGCAAGATATCGGATTAGGAA-3’ ... 5’-CGCGGATCCCTTGCCGATTTGGATCATTC-3’ 5’-GCTCTAGAATCTACAAACCTAAAACAAC-3’ 5’-TGCCCGCGGTCATAATATCACGGACCGCAT-3’ 5’-CGCGGATCCGAAAATTTGTTTGATTTTTAA-3’ 5’-GCTCTAGAAAGTACAGTCGGCATTAT-3’ 5’-CAATTGACCAGCCTTGAGCA-3’ ... 5’-GCTCTAGAAAGTACAGTCGGCATTAT-3’ 5’-CAATTGACCAGCCTTGAGCA-3’ 5’-ATAGCACCTGCACTATCGTCT-3’ 5’-CGCTCGTCAACTGATGGTATT-3’ 5’-GAACAATTCCTCGAGTATGG-3’ 5’-CGGCAAGATTTTTGCCGGAC-3’ 5’-GCGCATAGCCAAGAGAATTTG-3’ 5’-GCAGGTTTAGACCAACATTA-3’...
- 12
- 466
- 0
Báo cáo khoa học: Characterization of c-tocopherol methyltransferases from Capsicum annuum L and Arabidopsis thaliana pptx
... factor of 45 was similar to previously published results [15] Analysis of the most enriched fraction by SDS/ PAGE and sensitive silver staining revealed the presence of a range of bands A faint band ... Data were analyzed by linear regression using the statistic program of MS Of ce EXCEL (Microsoft, Deisenhofen, Germany) Statistics Substrate interaction kinetic experiments and product inhibition ... UV-irradiation for h according to Subbaramaiah and Simms [26] The protein was precipitated and re-dissolved as described by Wessels and Flugge [22] and ¨ separated by SDS/PAGE Radioactively labelled proteins...
- 9
- 581
- 0
Báo cáo khoa học: Probing suggested catalytic domains of glycosyltransferases by site-directed mutagenesis Tobias Hefner and Joachim Stockigt ¨ ppt
... Exchange of Lys86 against the neutral Ile resulted in only a slight increase of the Km-value and approximately 18% decrease of Vmax Replacement of Ala204 to Val caused a greater decrease of the ... between 55 and 60% for the substrates, hydroquinone and vanillin Fig Purity of arbutin synthase wild-type and mutant enzymes after Ni2-nitrilotriacetic acid chromatography SDS/PAGE and staining by Coomassie-blue ... reactions the Glu residue acts as Table Comparison of kinetic parameters of wild-type and muteins of arbutin synthase-(His)6 expressed in E coli Values of Km and kcat were calculated from Lineweaver–Burk...
- 6
- 282
- 0
Báo cáo khoa học: Characterization of a Cry1Ac-receptor alkaline phosphatase in susceptible and resistant Heliothis virescens larvae potx
... visualized by the formation of a purple-red precipitate Reactions were stopped by incubation of filters in 50 mL of NaCl/Pi, pH 7.5 containing 200 lL of 500 mM EDTA pH 8.0 Results Identification of the ... characteristic of N-linked glycans [33] Binding of both SBA and WFL suggested the presence of either GalNAc or galactose at the nonreducing end of the oligosaccharide Absence of RCA-I binding ... in at least three independent experiments Ligand, lectin and immunoblots of BBMV proteins BBMV proteins (15 or lg) were separated by SDS/PAGE 8%, and gels were either stained or electrotransferred...
- 9
- 399
- 0
Báo cáo Y học: Characterization of four substrates emphasizes kinetic similarity between insect and human C-domain angiotensin-converting enzyme pptx
... which an MS spectrum as well as several tandem MS (MS/ MS) spectra was acquired During MS/ MS fragment ions are generated from a selected precursor ion by collision induced dissociation [18] Because ... Identification of the purified peptides ESI-TOF MS confirmed the purity of the fractions and yielded the mass of the purified peptides summarized in Ó FEBS 2002 Ovary-derived ACE substrates and insect ... purified peptides with different kinds of ACE Protonated mass as determined by MS and Km values (lM) of the cleavage of the purified peptides with sACE, nACE, cACE and locust testis ACE Km (lM) Peptide...
- 9
- 404
- 2
Báo cáo khoa học: Characterization of sequence variations in human histone H1.2 and H1.4 subtypes pptx
... amplified by using the PCR primers 5¢-CCCAGGCGCTGCTTC-3¢ (nucleotides 469fi483 of the H1.2 gene) and 5¢-CTCTGACACCGGGGGAC-3¢ (nucleotides 651fi635 of the H1.2 gene) The PCR was performed with 50 ng of ... sequence variations in codon 18 of H1.2 and in codon 174 of H1.4 To obtain the frequency of the two polymorphisms in H1.2 and H1.4 in a normal popula- 3680 A 183 bp fragment of the H1.2 gene (HIST1H1C, ... structure of a segmented a helix [40] Replacement of lysine with arginine may affect the secondary structure of the C-terminal tail and the binding of H1.4 to chromatin, as arginine offers additional...
- 11
- 442
- 0
báo cáo hóa học: "Use of medications by people with chronic fatigue syndrome and healthy persons: a population-based study of fatiguing illness in Georgia" pptx
... The different profile of NSAIDs use by the CFS and Well groups (i.e., ibuprofen was most commonly used by the CFS group and aspirin was most commonly used by the Well group), seems to reflect different ... 63.4% of the CFS group, 58.3% of the ISF group and 72.7% of the Well group) Other reported reasons included anxiety (or "nerves") in 24.3% of the CFS group, 20.9% of the ISF group, and 9.1% of the ... characteristics of fatigue and we utilized the CDC CFS Symptom Inventory to document occurrence, frequency and severity of the defining symptoms [15] Subjects who had ≥ case defining symptoms and exceeded...
- 11
- 512
- 0
Báo cáo sinh học: " Genetic characterization of measles viruses isolated in Turkey during 2000 and 2001" pdf
... Figure Map of Turkey showing province and number of measles virus isolates obtained during 2000-2001 Figure virus isolates obtained during 2000–2001 Map of Turkey showing province and number of measles ... acids of the N protein were amplified by using a one-step RT-PCR kit according to manufacturer's protocol (Superscript, Invitrogen) Forward and reverse primers were: 5'GCTATGCCATGGGAGTAGGAGTGG and ... 5'GCTATGCCATGGGAGTAGGAGTGG and 5'CTGGCCCTCGGCCTCTCGCAC, respectively Sequences of the PCR products were derived by automated sequencing with the BigDye terminator VI.I Page of (page number not for citation...
- 5
- 390
- 0
báo cáo hóa học:" Genetic characterization of measles viruses isolated in Turkey during 2000 and 2001" potx
... Figure Map of Turkey showing province and number of measles virus isolates obtained during 2000-2001 Figure virus isolates obtained during 2000–2001 Map of Turkey showing province and number of measles ... acids of the N protein were amplified by using a one-step RT-PCR kit according to manufacturer's protocol (Superscript, Invitrogen) Forward and reverse primers were: 5'GCTATGCCATGGGAGTAGGAGTGG and ... 5'GCTATGCCATGGGAGTAGGAGTGG and 5'CTGGCCCTCGGCCTCTCGCAC, respectively Sequences of the PCR products were derived by automated sequencing with the BigDye terminator VI.I Page of (page number not for citation...
- 5
- 503
- 0
báo cáo hóa học:" Use of medications by people with chronic fatigue syndrome and healthy persons: a population-based study of fatiguing illness in Georgia" doc
... The different profile of NSAIDs use by the CFS and Well groups (i.e., ibuprofen was most commonly used by the CFS group and aspirin was most commonly used by the Well group), seems to reflect different ... 63.4% of the CFS group, 58.3% of the ISF group and 72.7% of the Well group) Other reported reasons included anxiety (or "nerves") in 24.3% of the CFS group, 20.9% of the ISF group, and 9.1% of the ... characteristics of fatigue and we utilized the CDC CFS Symptom Inventory to document occurrence, frequency and severity of the defining symptoms [15] Subjects who had ≥ case defining symptoms and exceeded...
- 11
- 498
- 0
báo cáo khoa học: " Characterization of PR-10 genes from eight Betula species and detection of Bet v 1 isoforms in birch pollen" pot
... screening of Bet v isoforms in birch pollen by determining presence and relative abundances of individual isoforms The pollen of four birch species contained a mixture of Bet v isoforms, with ... YYTK YHTK Analysis of Bet v isoforms by Q-TOF LC-MSE The tryptic digests of the 1618 kDa bands were examined in detail to elucidate the expression of separate Bet v isoforms in pollen Trypsin ... specific for both isoforms of gene 01A, while two others were specific for both isoforms of gene 01C Isoforms 02A01 and 02B01 could not be separated, so either one or both of them are expressed...
- 15
- 349
- 0
Báo cáo khoa học: " The construction and characterization of the bi-directional promoter between pp38 gene and 1.8-kb mRNA transcripts of Marek''''s disease viruses" doc
... GTgagctcTCGAGGCCACAAGAAATT AAgagctcGAGCATCGCGAAAGAGAG A GAggtaccTCGAGGCCACAAGAAATT TTTggtaccGTTCGCACCAGAGTCCA GAAgagctcGAGGCCACAAGAAATT AAgagctcGAGCATCGCGAAAGAGAG A AAAggtaccGCCGAGGTGAGCCAATC The sites opposite ... with 100 μl of DMEM medium free of serum and antibiotic These two solutions were mixed and incubated for 45 at room temperature and then added into another 800 μl DMEM A total of ml of the transfection ... constructs and directions of the promoter in promoter and schematic presentation of the bi-directional different The the The schematic presentation of the bi-directional promoter and the parts and directions...
- 6
- 386
- 0
Characterization of high efficiency pseudo bilayer organic solar cells and
... spectroscopy (TOF-SIMS) TOF – SIMS is used to determine the thickness profile of an organic layer This technique gives us the concentration of either P3HT or PCBM as a function of the depth of the device ... regeneration of the sensitizer by iodide prevents the recapture of the conduction band electron by the oxidized dye The iodide used up at the dye is regenerated in turn by the reduction of the triiodide ... presence of air and light Improving the efficiency of OSCs As discussed before, improving of PCEs of OSCs can not only occur due to improved absorption spectrum of the solar cells but also by better...
- 104
- 279
- 0
Báo cáo hóa học: " Catalytic pyrolysis of Laminaria japonica over nanoporous catalysts using Py-GC/MS" pdf
... from L japonica Characterization of catalysts As shown in Figure 1, the low angle of XRD pattern of Al-MCM-48 shows typical peaks of Al-MCM-48 and the high angle of XRD pattern of Meso-MFI is ... textural properties of the catalysts The BET surface area of Meso-MFI and Al-MCM-48 is 471 and 1, 219 cm2/g, respectively The pore size of the Al-MCM-48 and Meso-MFI is 2.9 and 4.1 nm, respectively ... temperature of the GC/ MS interface was 280°C, with the MS operated in the EI mode at 70 eV The program was run in the scanning range from 29 to 400 a.m.u at a rate of scans/s The identification of peaks...
- 7
- 365
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008