changes during the diauxic shift a paradigm for pathway analysis through mining databases and applying mathematical analysis

Báo cáo y học: "The Proteomic Code: a molecular recognition code for proteins" docx

Báo cáo y học: "The Proteomic Code: a molecular recognition code for proteins" docx

Ngày tải lên : 13/08/2014, 16:21
... Data Bank, PDB and Nucleic Acid Data Bank, NDB) contain all the information about these co-locations; however, it is not an easy task to penetrate this complex information We developed a JAVA ... expressed by the direct mRNA and it does not matter if they are read in the same or opposite directions A possible explanation is that many codons are actually symmetrical and have the same meaning ... positively charged amino acid ((+) and red dots), for example arginine, remains attached to its codon The mRNA forms a loop because the 1st and 3rd bases are locally complementary to each other in...
  • 44
  • 418
  • 0
Báo cáo khoa học: A novel plant protein disulfide isomerase family homologous to animal P5 – molecular cloning and characterization as a functional protein for folding of soybean seed-storage proteins docx

Báo cáo khoa học: A novel plant protein disulfide isomerase family homologous to animal P5 – molecular cloning and characterization as a functional protein for folding of soybean seed-storage proteins docx

Ngày tải lên : 30/03/2014, 04:20
... TGTAAAG TGTAAAG + ) + )95 )1100 )1470 ACACacG ACACttG ACACaaG + + + + ) ) ) ) ) )140 )1100 )1596 )1632 )140 )1100 )1596 )1632 )1874 CAaaTG CAagTG CAaaTG CAaaTG CAaaTG CActTG CAttTG CAgtTG TGAGTCA ... RT-PCR Each value was standardized by dividing the value by that for actin mRNA Values are calculated as a percentage of the highest value obtained during maturation Data represent the mean ± SD for ... putative signal peptide was constructed as follows The DNA fragment was amplified from GmPDIM cDNA by PCR using the primers 5¢-GACGACGACAAGATGC ACGCACTCTATGGAGC-3¢ and 5¢-GAGGAGAAGC CCGGTTCATAGCTCATCCTTGCTTGAAG-3¢...
  • 12
  • 348
  • 0
Báo cáo hóa học: "Reference values and physiological characterization of a specific isolated pig kidney perfusion model" doc

Báo cáo hóa học: "Reference values and physiological characterization of a specific isolated pig kidney perfusion model" doc

Ngày tải lên : 20/06/2014, 00:20
... to examine the creatinine clearance used as approximation of the glomerular filtration rate (GFR) The creatinine clearance represents the mathematical product of the U/Pcrea quotient and the urine-flow ... solution) was driven by a roller pump The dialysate circuit meets the metabolic demands of the organ and, therefore, is permanently oxygenated and nutritional substrates are added as well as cre- Table ... x, y data are transformed into logarithmic scaling and linear lines instead of curves are resulting for constant values of the creatinine clearance In that way figure was constructed and the interrelation...
  • 13
  • 548
  • 0
Báo cáo hóa học: " Design and Characterization of a 5.2 GHz/2.4 GHz ΣΔ Fractional-N Frequency Synthesizer for Low-Phase Noise Performance" potx

Báo cáo hóa học: " Design and Characterization of a 5.2 GHz/2.4 GHz ΣΔ Fractional-N Frequency Synthesizer for Low-Phase Noise Performance" potx

Ngày tải lên : 22/06/2014, 22:20
... normally a commercially available part and data on its phase noise performance is often available from the manufacturer The ΣΔ phase noise can be estimated from (24) Note that the maximum fractionality ... has been analyzed Analyzing an example synthesizer RFIC designed for multiband MIMO WLAN applications has validated the theory The analytical model achieved good agreements with measured synthesizer ... noise and spurs at the synthesizer output observed using a spectrum analyzer WLAN applications The comparison between the simulated and the measured phase noise demonstrates that the analytical...
  • 11
  • 416
  • 0
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

Ngày tải lên : 23/03/2014, 13:20
... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGCTCGTGTTGACGCAGCCGCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCCAGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGATGTTGTGATGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC...
  • 11
  • 679
  • 0
Báo cáo hóa học: " Nucleotide mismatches between the VP7 gene and the primer are associated with genotyping failure of a specific lineage from G1 rotavirus strains" potx

Báo cáo hóa học: " Nucleotide mismatches between the VP7 gene and the primer are associated with genotyping failure of a specific lineage from G1 rotavirus strains" potx

Ngày tải lên : 20/06/2014, 01:20
... from database, performed the sequences analysis and critically revised the manuscript 14 16 18 19 Acknowledgements We are grateful to Natalia Gudiño for the language corrections of the manuscript, ... Dutta P, Bhattacharya SK, Krishnan T, Kobayashi N, Naik TN: Genetic variability of human rotavirus strains isolated from Eastern and Northern India J Med Virol 2004, 72:156-161 Rahman M, Sultana ... 2001:1747-1785 Martella V, Ciarlet M, Baselga R, Arista S, Elia G, Lorusso E, Banyai K, Terio V, Madio A, Ruggeri FM, Falcone E, Camero M, Decaro N, Buonavoglia C: Sequence analysis of the VP7 and VP4...
  • 4
  • 329
  • 0
Báo cáo y học: "Validation of a specific measure to assess healthrelated quality of life in patients with schizophrenia and bipolar disorder: the ‘Tolerability and quality of life’ (TOOL) questionnaire" doc

Báo cáo y học: "Validation of a specific measure to assess healthrelated quality of life in patients with schizophrenia and bipolar disorder: the ‘Tolerability and quality of life’ (TOOL) questionnaire" doc

Ngày tải lên : 09/08/2014, 01:21
... 68 patients per group Data tabulation, database validation and the statistical analyses were carried out using the statistical packages SPSS (version 14.0; SPSS, Chicago, IL, USA) and Stata (version ... statistical analyses All authors made meaningful contributions to data interpretation ALM, JC, and JM cowrote the final draft of the manuscript All authors read and approved the final manuscript ... thank Aurelio Garc a, Juan José Uriarte, and Fermín Mayoral for their contribution in the linguistic validation Author details Department of Psychiatry, Hospital Universitario de Salamanca, Salamanca,...
  • 8
  • 476
  • 0
Báo cáo y học: "Association of a specific haplotype across the genes MMP1 and MMP3 with radiographic joint destruction in rheumatoid arthritis" ppt

Báo cáo y học: "Association of a specific haplotype across the genes MMP1 and MMP3 with radiographic joint destruction in rheumatoid arthritis" ppt

Ngày tải lên : 09/08/2014, 01:23
... radiograph was obtained after a median of year, the second after a median of years and the third after a median of 14 years after disease onset The total Ratingen score refers to the last radiograph ... collected clinical data and all blood samples and radiographs and scored them by means of the Ratingen score UW carried out the HLA typing BM-M performed the statistical analysis IH supervised all experimental ... modified disease activity score was calculated as described [27] Available online http://arthritis-research.com/content/6/3/R199 Radiographic analysis Radiographic damage of hands and feet was assessed...
  • 9
  • 357
  • 0
Báo cáo y học: "The identification and characterization of a novel protein, c19orf10, in the synovium" docx

Báo cáo y học: "The identification and characterization of a novel protein, c19orf10, in the synovium" docx

Ngày tải lên : 09/08/2014, 10:20
... to the maintenance of synovial inflammation, aggravating the destruction of cartilage and bone and stimulating the development of the pannus Because FLSs can exhibit significant phenotypic changes ... similar patterns of reactivity in a comparative staining analysis These antibodies were all of the IgM class and this may be attributable to the fact that there is 91% identity between the predicted ... and either CD68 as a marker for macrophage-like cells or CD59 as a marker for fibroblasts There is clear colocalization of CD59 and c19orf10 staining throughout the synovial lining and in the underlying...
  • 9
  • 489
  • 0
báo cáo khoa học: "Design and characterization of protein-quercetin bioactive nanoparticles" doc

báo cáo khoa học: "Design and characterization of protein-quercetin bioactive nanoparticles" doc

Ngày tải lên : 11/08/2014, 00:23
... presented in Table indicates the loss of the a- helix during aggregation Meanwhile, the broadening of this band and the increase of the band intensity at 1665 cm-1 implies the increase of the random-coil ... Excess ammonium sulphate was added to the beaker, and the mixture was stirred for 10 and then left to stand for 20 A mL solution was transferred to a centrifuge tube, and then centrifuged for 30 at ... was calculated using Eq Additional material Additional file 1: Fitting results of the different modes on the experimental data The concentration of BSA (A and B), Lys (A and B’), or Mb (A ’ and...
  • 14
  • 290
  • 0
Design and characterization of functional novel oligopeptides

Design and characterization of functional novel oligopeptides

Ngày tải lên : 04/10/2015, 10:25
... to the following post-docs, Dr Parayil Kumaran Ajikumar and Dr Lakshminarayanan Rajamani, in their helpful and invaluable advice and encouragement during the course of my research I would also ... Calcium carbonate is the most abundant mineral observed in nature and exists in three forms, namely calcite, vaterite and aragonite [46] Among these, calcite is the most thermodynamically stable ... contained in a column through which reagents and solvents are pumped and removed continuously A range of manual, semi-automatic or automatic synthesizers are commercially available for both batch-wise...
  • 95
  • 274
  • 0
Design and characterization of interposers for high speed fine pitch wafer level packaged device testing

Design and characterization of interposers for high speed fine pitch wafer level packaged device testing

Ngày tải lên : 04/10/2015, 10:25
... thank my family and friends I am thankful to my parents, Michael Tan and See Siew Kean, my brother, David and my sister, Janice, for their constant support and love I thank my great friend, Tan ... shaping, planarity, final alignment, and quality assurance processes Blade card design parameters are similar to those for epoxy cards, with the exception of the blade There are three main blade ... to each other Varying the width of the blade shank increases or decreases the surface area where the blade is attached to the probe This affects the flexibility of the wire probe and the contact...
  • 126
  • 202
  • 0
Tài liệu Báo cáo khoa học: Characterization of a chemosensory protein (ASP3c) from honeybee (Apis mellifera L.) as a brood pheromone carrier pdf

Tài liệu Báo cáo khoa học: Characterization of a chemosensory protein (ASP3c) from honeybee (Apis mellifera L.) as a brood pheromone carrier pdf

Ngày tải lên : 21/02/2014, 03:20
... signal peptide was amplified by PCR using the following primers: 5¢ primer, 5¢-GAGCCCGGATCCACCATGAA GGTCTCAATAATT 3¢; 3¢ primer, 5¢-CTGACG GAAT TCTTAAACATTAATGCC 3¢ These primers encoded a Kozak ... that probably resulted in a compact conformation that was resistant to cleavage CD analysis and oligomerization The far-UV CD spectrum of ASP3c at neutral pH (Fig 5A) displayed a positive peak ... recombinant ASP3c (A) SDS/PAGE analysis of recombinant ASP3c secreted by Pichia pastoris Lane shows standards (Low range and Polypeptide kits, Bio-Rad, France) and lanes 2–5 are 50-lL aliquots...
  • 11
  • 642
  • 0
Báo cáo khoa học: Characterization of the role of a trimeric protein phosphatase complex in recovery from cisplatin-induced versus noncrosslinking DNA damage potx

Báo cáo khoa học: Characterization of the role of a trimeric protein phosphatase complex in recovery from cisplatin-induced versus noncrosslinking DNA damage potx

Ngày tải lên : 30/03/2014, 04:20
... this is the case, removal from the action of the ataxia telangiectasia mutated (ATM) ⁄ ataxia telangiectasia and RAD53 related (ATR) kinases at the site of DNA damage may decrease the kinase ⁄ ... phosphorylation in the WT strain after h, a pronounced decrease at h, and a return to the unphosphorylated basal state by h In contrast, Rad53p was phosphorylated at h and remained at least partially ... Yeast strains and general methods All methods for the manipulation of yeast and preparation of media were performed according to standard protocols [30] The growth conditions for the yeast strains...
  • 11
  • 362
  • 0
Báo cáo khoa học: Proteome analysis of a rat liver nuclear insoluble protein fraction and localization of a novel protein, ISP36, to compartments in the interchromatin space pptx

Báo cáo khoa học: Proteome analysis of a rat liver nuclear insoluble protein fraction and localization of a novel protein, ISP36, to compartments in the interchromatin space pptx

Ngày tải lên : 30/03/2014, 20:20
... human cells J Cell Sci 108, 635–644 10 Jagatheesan G, Thanumalayan S, Muralikrishna B, Rangaraj N, Karande AA & Parnaik VK (1999) Colocalization of intranuclear lamin foci with RNA splicing factors ... that associates with nuclear matrix DNA Cell Biol 17, 849–858 Lee JY, Nakane Y, Koshikawa N, Nakayama K, Hayashi M & Takenaga K (2000) Characterization of a zinc finger protein ZAN75: nuclear ... 58 B E B A A A A A A A A C A B D A A A A B A 71 47 217 42 S S M S 1 – – – 25 – B A C A 67 130 160 98 S S M M – – – 13 30 A A B B Accession no in the NCBI protein database proteins Filamentous...
  • 12
  • 400
  • 0
Knowledge transfer in Tehran University of Medical Sciences: an academic example of a developing country pdf

Knowledge transfer in Tehran University of Medical Sciences: an academic example of a developing country pdf

Ngày tải lên : 11/08/2014, 05:21
... designed and conducted the study SN, MG, MS, and MA gathered the data KM assisted in interpreting the statistical analysis and manuscript writing All authors approved the final manuscript Additional ... performance was 4.00 (SD = 3.03) that formed 22% of the total score The maximum score attainable in the active strategies was six and the mean score of the researchers' performance in these strategies ... questionnaire The difference between these two groups was not statistically significant (p = 0.17) Data analysis Apart from the usual descriptive statistics for data analysis, multi-variable linear...
  • 8
  • 341
  • 0
báo cáo khoa học: " Knowledge transfer in Tehran University of Medical Sciences: an academic example of a developing country" pot

báo cáo khoa học: " Knowledge transfer in Tehran University of Medical Sciences: an academic example of a developing country" pot

Ngày tải lên : 11/08/2014, 16:21
... designed and conducted the study SN, MG, MS, and MA gathered the data KM assisted in interpreting the statistical analysis and manuscript writing All authors approved the final manuscript Additional ... performance was 4.00 (SD = 3.03) that formed 22% of the total score The maximum score attainable in the active strategies was six and the mean score of the researchers' performance in these strategies ... questionnaire The difference between these two groups was not statistically significant (p = 0.17) Data analysis Apart from the usual descriptive statistics for data analysis, multi-variable linear...
  • 8
  • 315
  • 0
Magnetic resonance spectroscopy correlation with histological analysis in gliomas and structure determination of a hypothetical protein

Magnetic resonance spectroscopy correlation with histological analysis in gliomas and structure determination of a hypothetical protein

Ngày tải lên : 10/11/2015, 11:35
... physiologically relevant range Most studied metabolites in brain are Acetate, N-Acetyl aspartate (NAA), N-Acetylaspartylglutamate (NAAG), Alanine, Choline, Creatine, Glutamate, Glycine, Myo-inositol, Lactate, ... lipids and unsuppressed water, and low signal-to-noise ratios The analysis of such data is greatly facilitated by incorporating priori spectral information in a parametric modeling approach Chemical ... anatomical and morphological information must be evaluated for clarification of normal functions of the brain and clinical diagnosis An advantageous property of NMR that plays an important role...
  • 92
  • 284
  • 0
Báo cáo khóa học: Functional properties of the protein disulfide oxidoreductase from the archaeon Pyrococcus furiosus A member of a novel protein family related to protein disulfide-isomerase doc

Báo cáo khóa học: Functional properties of the protein disulfide oxidoreductase from the archaeon Pyrococcus furiosus A member of a novel protein family related to protein disulfide-isomerase doc

Ngày tải lên : 16/03/2014, 16:20
... K., Takahashi, M., Sekine, M., Baba, S., Ankai, A. , Kosugi, H., Hosoyama, A. , Fukui, S., Nagai, Y., Nishijima, K., Otsuka, R., Nakazawa, H., Takamiya, M., Kato, Y., Yoshizawa, T., Tanaka, T., ... of Thermoplasma volcanium Proc Natl Acad Sci USA 97, 14257–14262 49 Kawarabayasi, Y., Hino, Y., Horikawa, H., Yamazaki, S., Haikawa, Y., Jin-n., o, K., Takahashi, M., Sekine, M., Baba, S., Ankai, ... indicating their importance The genomes of the hyperthemophilic bacteria Aquifex aeolicus, Thermotoga maritima and Thermoanaerobacter tengcongensis not encode a protein related to bacterial DsbA and...
  • 12
  • 506
  • 0