challenge—and a new game
In order to become competent in a foreign language, it is important for language learners not only to acquire new vocabularies and a new set of phonological and syntactic rules but also to learn what Wilson (1986)
Ngày tải lên :
17/04/2013, 16:09
... ngữ Nam Bộ Như vậy, không gian đ a lí tiếng miền Nam, phương ngữ miền Nam hay phương ngữ Nam tác giả xác đònh rộng Không gian đ a lí phương ngữ Nam Bộ xác đònh hẹp Ranh giới PNNB trùng với ranh ... (từ thû ấy/ đến nay), thû (từ thû ấy/ đến giờ) V a rút gọn v a đảo trật tự câu nghi vấn tính chất, đặc điểm: bao cao (cao bao nhiêu), bao dai (dài bao nhiêu), bao lớn (lớn bao nhiêu)… Rút gọn, ... Long An, Tiền Giang, An -18- Giang, Kiên Giang, Cà Mau, Sóc Trăng, Bạc Liêu, Đồng Tháp, Bến Tre, Hậu Giang, Vónh Long, Trà Vinh thành phố Cần Thơ Vò trí đ a lí Nam Bộ: ph a bắc tây - bắc giáp Cam-pu-chia,...
- 137
- 853
- 0
Đề tài " Analytic representation of functions and a new quasianalyticity threshold " doc
Ngày tải lên :
29/03/2014, 07:20
... Annals of Mathematics, 164 (2006), 1033–1064 Analytic representation of functions and a new quasi-analyticity threshold By Gady Kozma and Alexander Olevski˘ ı* Abstract We characterize ... boundary value of a Nevanlinna class function That example is L∞ and can be made continuous, but it cannot be made smooth in any reasonable sense without leaving the Nevanlinna class 2.4 The harmonic ... n∈Z where ω satisfies (9) As far as we are aware this condition has never appeared before as a smoothness threshold We mention that whereas the usual quasi-analyticity is placed near the “right...
- 33
- 293
- 0
RBF Neurals Networks and a new algorithm for training RBF networks
Ngày tải lên :
12/04/2014, 15:40
... California from the 1990 Cens us In this sample a block group on average includes 1425.5 individuals living in a geographically compact area Naturally, the geographical area included varies inversely ... D.S Bromhead and D Lowe, “Multivariable functional interpolation and adaptive networks”, Complex Systems, vol 2, 1988, pp 321-355 J.Park and I.W Sandberg “Approximation and radial-basis-function ... NOISE DATA With training in equally spaced nodes, the HDH-1 phase can be apply in many applications which needs fast training time such as in computer graphics, pattern recognition To get the maximum...
- 22
- 270
- 0
Báo cáo hóa học: " Widespread distribution and a new recombinant species of Brazilian virus associated with cotton blue disease" pot
Ngày tải lên :
20/06/2014, 01:20
... Piracicaba – SP Piracicaba – SP Piracicaba – SP Piracicaba – SP Brasília – DF Brasília – DF Acreuna – GO Presidente Olegário -MG Holambra – SP Primavera Leste – MT Primavera Leste – MT Primavera Leste ... Location1 Cotton sp Cultivar Isolate Date Symptom2 Nested PCR Cascavel – PR Cascavel – PR Cascavel – PR Cascavel – PR Cascavel – PR Sta Helena de Goiás – GO Piracicaba – SP Piracicaba – SP Piracicaba ... typical typical typical typical typical typical typical typical typical typical typical typical typical typical atypical typical typical atypical typical typical atypical typical + + + + + + + + + +...
- 13
- 386
- 0
Báo cáo toán học: " An introduction to 2-fuzzy n-normed linear spaces and a new perspective to the Mazur-Ulam problem" docx
Ngày tải lên :
20/06/2014, 21:20
... space onto a real normed linear space is a linear mapping up to translation Baker [12] showed an isometry from a real normed linear space into a strictly convex real normed linear space is a ne ... Sciences, Hanyang University, Seoul 133-791, Korea Department of Mathematics, Faculty of Science and Arts, Celal Bayar University, 45140 Manisa, Turkey ∗ Corresponding author: cihangiralaca@yahoo.com.tr ... An introduction to 2-fuzzy n-normed linear spaces and a new perspective to the Mazur–Ulam problem Choonkil Park1 and Cihangir Alaca∗2 Department of Mathematics, Research Institute for Natural...
- 39
- 371
- 0
Báo cáo hóa học: " Research Article ML-PDA: Advances and a New Multitarget Approach" potx
Ngày tải lên :
22/06/2014, 19:20
... residual data set the ML-PDA algorithm is applied and the resulting track estimate validated If a new target is validated, its associated measurements are also edited out to form a new residual data ... frames of data, track estimates separated by fewer than Nw frames are correlated in that they use common data frame(s) EURASIP Journal on Advances in Signal Processing Table 3: Scenario parameters ... optimization routine be at a local maximum That is for the bearing, range, range rate measurement, the LLR will be at a constant (local maximum) value for all values of tangential velocity In areas...
- 13
- 212
- 0
Báo cáo y học: "Ventilator-associated tracheobronchitis (VAT): questions, answers, and a new paradigm" ppt
Ngày tải lên :
13/08/2014, 11:22
... Thoracic Society and Infectious Diseases Society of America (ATS/IDSA): Guideline for the Management of Adults with Hospital-acquired, Ventilator-associated, and Healthcareassociated Pneumonia Am ... systematically to exclude VAP The data of Nseir and coworkers [1] need confirmation but suggest a new paradigm to assess tracheal colonization, whether treating VAT or early VAP Also, treatment ... independent data analysis and data safety monitoring boards, that would greatly increase our understanding of disease pathogenesis, prevention, and treatment Such a network could provide a foundation...
- 2
- 199
- 0
optimization of protein and rna detection methodologies and a new approach for manipulating protein activity in living cells
Ngày tải lên :
13/11/2014, 10:46
... TTTTGCGGCCGCCMNNMNNMNNGCAGCAGCCGGGGCAGCA AATACGACTCACTATAGGGA GTAATCCAGAGGTTGATTCTCGAGAAAA TTTTAAGCTTGCCACCATGGCCGGATCCTAAGCGGCCGCAGCAAGGGCGAGGAG CTG 10 CCCCATCGATCTCGAGTTACTTGTACAGCTCGTCCAT 11 ACCTACAGGTGGGGTCTTTCATTCCC ... 12 AGCTCGTTTAGTGAACCGTCAGATC 13 GACAAGCGGCCGCTTAAGAACCGC 14 AAACTCGAGTTAGCGGCCGCCCCTCCACATGCAG 15 AAAGCGGCCGCCAGAACCGCAGCACCCGGGGCA 16 TTTGCGGCCGCATGGATGATGATATCGCCGCG 17 TTTCTCGAGCTAGAAGCATTTGCGGTGGAC ... TTTCTCGAGCTAGAAGCATTTGCGGTGGAC 18 CTCAGATCTCGGGCTATGGATGATGATATCGCCGC 19 TCGAGATCTGAGTCCGGACTTGTACAGCTCGTCCATG 20 TTTAAGCTTGCCACCATGGATTACAAGGATGACGACGATAAGGGATCCGCCGGAT CCTTTTTGAATTG 32 Table 1.2 Continued 21 TTTAAGCTTGCCACCATGGTGTACCCCTACGACGTGCCCGACTACGCCGGATCCG...
- 144
- 306
- 0
A novel role of hydrogen sulfide in wound healing and a new approach to wound dressing in rat model
Ngày tải lên :
26/09/2015, 09:39
... Materials and Methods Statistical analysis Data are presented as mean ± SE Statistical significance was analyzed by variance (ANOVA), a Tukey test was applied when necessary for comparisons A value ... area at day is defined as 100 percent original area, the areas at day 3, and are calculated as the percentage of the original area for each group of rats The data of 6th day suggests the largest ... regulates many essential functions such as maintaining background vasodilatation in small arteries and arterioles, regulation of microvascular and epithelial permeability NO’s role as a neurotransmitter...
- 80
- 424
- 0
A facile construction of the tricyclic 5 7 6 scaffold of fungi derived diterpenoids the rst total synthesisof (±) heptemerone g and a new approach to danishefsky s intermediate for a guanacastepene
Ngày tải lên :
26/01/2016, 09:27
... ethanol15 to give alkene 10 Careful acetylation of 10 with acetic anhydride and DMAP in dichloromethane gave the acetate 11 contaminated with (presumably) its cis-azulene epimer (10% by H NMR) All ... comparison To complete the formal synthesis of guanacastepene A (1), diol 24 was dissolved in acetone and treated with a catalytic amount of p-toluenesulfonic acid Compound was obtained (crystalline ... tert-butyl acetate22 (generated from tert-butyl acetate and LDA in THF at À78 °C) to 21 afforded an adduct that was desilylated without purification The mixture of diols 22 so obtained was oxidized...
- 3
- 547
- 0
Vietnamese chitin raw material, the chitin de n acetylation reaction, and a new chitosan alginate gelling concept
Ngày tải lên :
18/07/2016, 20:13
... chitosan by performing a detailed study of the de-N-acetylation reaction with the chitin disaccharide as a model substance, and finally to investigate an advanced application of a new chitosan – alginate ... neurotoxic (Beauchamp et al., 1992) and glyoxal is mutagenic (MurataKamiya et al., 1997) Genipin is a naturally occurring material that offers an interesting alternative to dialdehydes and is not ... therefore the calculated DA values IR methods are therefore generally used for qualitative rather than quantitative DA analysis (Kasaai, 2008) Ultra-violet spectroscopy (UV) The wide availability of...
- 119
- 370
- 0
24973 basketball a new game
Ngày tải lên :
27/08/2016, 07:06
... infinitive p.simple p part meaning infinitive p.simple p part meaning ...
- 2
- 97
- 0
Báo cáo y học: "Rasburicase represents a new tool for hyperuricemia in tumor lysis syndrome and in gout Lisa Cammalleri and Mariano Malaguarnera"
Ngày tải lên :
31/10/2012, 14:59
... prevent and treat hyperuricemia include allopurinol and alkalinization, associated with an aggressive hydration Rasburicase presents various features that give it a more favourable profile than standard ... because each metabolic derangement is associated with remarkable clinical manifestations Hyperuricemia and hyperphosphatemia severely worsen renal functionality; hyperkalemia and hypocalcemia ... hyperuricemia [21-24] Contemporary use of alkalinization, hydration and rasburicase at 0.10 mg/kg for 3-5 days maintains the same efficacy [25] Anyway, we may have favourable issues by changing the...
- 11
- 715
- 0
A new approach to semantic and syntactic functions of English adjectives – A contrastive analysis with their Vietnamese equivalents
Ngày tải lên :
10/04/2013, 14:46
... implications 2.2.2 Gradable and non- gradable adjectives According to L G Alexander (1988, 108) adjectives can be also divided into gradable and non- gradable Gradable adjectives mean a large class ... should be washed everyday Nguyễn Thị Nga K 1 1A 19 Graduation paper 2.2.5 Exclamatory adjective sentence An adjective as head of an adjective phrase or as its sole realization can be an exclamation: ... now C .A plays an important role in learning a foreign language as a main subject at most language universals According to C James (1980;19), C .A is a form of inter-language study and a central concern...
- 44
- 1.8K
- 7
Once Its rationale, collective defense poses new challenge to a larger NATO
Ngày tải lên :
19/07/2013, 16:34
... be blamed for worsening the situation The West then mounted a propaganda attack against Russia, with the American news media leading the way The news coverage has been far from fair and balanced, ... including India, Pakistan, Mongolia and Afghanistan, whose delegation was headed by President Hamid Karzai The Shanghai Cooperation Organization was created in 2001 to improve regional coordination on ... crushed a liberal reform movement in the Warsaw Pact nation In Vienna, a senior Georgian official said Russian forces and their armed allies have driven all Georgians out of South Ossetia and Abkhazia...
- 35
- 308
- 0
CHAPTER ELEVEN MIND MAPPING a NEW DIMENSION IN THINKING AND NOTE TAKING
Ngày tải lên :
09/08/2013, 11:51
... recall of each story you use a card filing system For each story you have one card for the title and author, and a card for every paragraph On each of these paragraph cards you enter a main and ... ideas from Kusa-Hibari main secondary paragraph paragraph paragraph paragraph paragraph Below you will find sample key words and phrases from the notes of students who have previously done this ... main and secondary idea for the first five paragraphs only, in the space provided on page 76 72 NOTING Kusa-Hibari Lafcadio Hearne His cage is exactly two Japanese inches high and one inch and...
- 52
- 671
- 0
Tài liệu tiếng anh Điện tử công suất mạch MERS A new AC current switch called MERS with low on state voltage IGBTs for renewable energy and power saving applications
Ngày tải lên :
15/10/2013, 16:10
... terminals will not lead to a short of the transistors Additionally, the capacitor is smaller than a normal voltage source converter Based on these characteristics, a new low on-state voltage IGBT ... losses are comparatively high The relative losses for a real scale system have been estimated and also included in the figure By increasing the dc-link voltage, and as a result the no-load voltage ... capacitance, small capacitors (0.47 μF) were connected in parallel to each IGBT Voltages across three IGBTs are also shown in Fig 18 (a) Good voltage sharing can be seen even though no special...
- 8
- 888
- 1
Getting Started With ASP.NET ASP.NET is a new and powerful technology for writing dynamic web pages.
Ngày tải lên :
06/11/2013, 00:15
... is also very powerful, faster than ASP, and instantly familiar to Java programmers It allows the Java program to leverage the aspects of the Java2 platform such as JavaBeans and the Java libraries ... support via something known as the Java Virtual Machine (JVM), and there are several standard and non-standard tags that are used to add Java applets to a web page These tags tell ... than Java, and also you don't have to worry about integrating different languages into the page, as Curl is capable of providing the same features as both Java and JavaScript 16 Getting Started...
- 792
- 596
- 0
Tài liệu Create a Dialog Box to Connect to a New Database, Including Listing Available SQL Servers and Databases pdf
Ngày tải lên :
21/01/2014, 12:20
... As Integer Dim oNames As SQLDMO.NameList Dim oSQLApp As New SQLDMO.Application() ' Load available SQL Servers into a NameList ' (those that are able to be seen by the network) oNames = oSQLApp.ListAvailableSQLServers ... same module as step 2, create the routine called LoadSQLServers After establishing an instance of the SQL-DMO application, the code calls the ListAvailableSQLServer method If no names are loaded ... Repopulating the List Boxes Based on the Current Category Selected Private Sub lstDatabases_SelectedIndexChanged(ByVal sender As System.Object, _ ByVal e As System.EventArgs) _ Handles lstDatabases.SelectedIndexChanged...
- 10
- 477
- 0
Tài liệu SEXUAL HEALTH EDUCATION A T SCHOOL AND A T HOME: ATTITUDES AND EXPERIENCES OF NEW BRUNSWICK PARENTS pptx
Ngày tải lên :
14/02/2014, 14:20
... homosexuality and relationships have no place in an academic institution Issues such as avoiding sexual abuse and awareness of The Canadian Journal of Human Sexuality, Vol 11 (1) Spring 2002 Table ... rural Ontario (McKay et al., 1998) and 95% in rural Nova Scotia (Langille et al., 1996), and suggests that the fears teachers and administrators have of parental and community opposition may ... Canadian Journal of Human Sexuality, Vol 11 (1) Spring 2002 ATTITUDES TOWARD SEXUAL HEALTH EDUCATION Although a vocal minority can create the impression that parental objections to school-based...
- 13
- 473
- 0