ce joerss d wolff d 2009 a prospective clinical study to evaluate the effect of manual and power toothbrushes on pre existing gingival recessions j contemp dent pract 1 10 4 1 8
A computational study to investigate the effects of insulation and EGR in a diesel engine
... zone) and then propagated to pre and main chamber at 380 °CA Also the development of the temperature fields at three cases between 360 and 380 °CA show that the axial and the radial penetrations ... observed for flame propagation at other crank angles At Figures 11 b, 11 c, 11 e, 11 f the production of NOx and soot in the main and prechamber are discussed for three cases at both part and full loads ... be 384 K The Present work includes study of three operating conditions of engine: base line, adiabatic and also adding EGR to the initial charge of adiabatic case at two load operating conditions:...
- 20
- 643
- 0
báo cáo khoa học: "A Study to investigate the role of p27 and Cyclin E immunoexpression as a prognostic factor in early breast carcinoma" pptx
... breast carcinomas are characterised by different interrelationships among markers related to angiogenesis and hormone dependence Br J Cancer 2002, 87 (10 ) :11 05 -11 11 Orlando L, Renne G, Rocca A, ... Hospital, UK 16 17 18 19 Authors’ contributions KP and RC conceived the study HM optimised the antibodies and performed the stains KP collected the cases and clinical information, interpreted the ... cancer cases obtained from AA and Caucasian patients who were matched on age, stage, oestrogen receptor status, and year of diagnosis [30] They found that cyclin D1 , p53, p27, and p 21 expression...
- 9
- 423
- 0
báo cáo khoa học: "Helping hands: A cluster randomised trial to evaluate the effectiveness of two different strategies for promoting hand hygiene in hospital nurses" ppsx
... the revisions TVA, LS, RG, and MH contributed to drafting of the manuscript GB is the statistician and performed the power calculation, the sample size considerations, and offered advice on the ... considerably add to the general body of knowledge by evaluation of the added value of the extended strategy as compared to the state -of -the- art strategy Results from our study will allow us to ... should address existing problems and barriers [ 21, 39 ,40 ] Grol and Grimshaw studied the failing implementation of evidence on hand hygiene in the healthcare setting and identified a variety of barriers...
- 9
- 521
- 0
Báo cáo y học: "A case-series study to explore the efficacy of foot orthoses in treating first metatarsophalangeal joint pain" pot
... undertook the clinical investigations and contributed to the data analysis and writing of the manuscript AMK contributed to the study design, clinical and laboratory investigations and to the data analysis ... analysis and writing of the manuscript ACR contributed to the laboratory investigations and contributed to the data analysis and writing of the manuscript NC contributed to the study design and writing ... Clinically important change in the visual analog scale after adequate pain control Acad Emerg Med 2003, 10 (10 ) :11 28 -11 30 28 Redmond AC, Crosbie J, Ouvrier RA: Development and validation of a novel...
- 9
- 451
- 0
Báo cáo khoa học: "A pilot study to assess the feasibility of evaluation of markers of response to chemotherapy at one day & 21 days after first cycle of chemotherapy in carcinoma of breast: a prospective non-randomized observational study" potx
... any other procedure related complications Range Age (years) 51 ( ± 8 .4) 31 63 Duration of symptoms (months) 10 . 54 ( ± 10 .88 ) 0.25 – 40 Age at Menarche (years) 14 .16 ( ± 1. 7) 11 18 21. 58 ( ± 4. 26) ... chemotherapy Breast Cancer Res Treat 19 98, 48 :10 7 -11 6 Lipponen P, Aaltomaa S, Kosma VM, Syrjanen K: Apoptosis in breast cancer as related to histopathological characteristics and prognosis Eur J ... World Journal of Surgical Oncology 2009, 7:35 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 Breast Cancer Therapy Edited by: Ragaz J, Ariel IM Berlin: SpringerVerlag; 19 91: 382 - 41 5 McCready DR,...
- 11
- 393
- 0
Báo cáo khoa học: "Parotid gland-recovery after radiotherapy in the head and neck region: 36 months follow-up of a prospective clinical study" pdf
... Patients n Dose (Gy) 10 2 34. 4 15 21. 7 Standard Deviation 13 .6 p 0.0 01 6.2 21 Table Mean and standard deviation of relative salivary flow rate at 1, 6, 12 , 24, and 36 months after radiotherapy Patients ... follow-up, and added to the data of the IMRT patients enrolled in study Grant No 10 84 2 9 Treatment planning, definition of target volumes and radiation dose All patients received 3D- CRT or IMRT, the ... [Quantitative and qualitative investigations of salivary gland function in dependence on irradiation dose and volume for reduction of xerostomia in patients with head -and- neck cancer] Strahlenther Onkol...
- 25
- 342
- 0
Báo cáo y học: "Systemic TNF blockade does not modulate synovial expression of the pro-inflammatory mediator HMGB1 in rheumatoid arthritis patients – a prospective clinical study" ppt
... CAAAAGCCTTCATACATC; and for HMGB1, forward ATTGGTGATGTTGCGAAGAA and reverse GATCCACAGCAACTCCAGAA The volume was adjusted to 15 .5 μl using RNase-free water, and the mixture was then incubated for 10 minutes ... the pathogenesis of rheumatoid arthritis as a novel cytokine Arthritis Rheum 2003, 48 :9 71- 9 81 Andersson U, Tracey KJ: HMGB1 as a mediator of necrosisinduced inflammation and a therapeutic target ... Ivanova S, Borovikova L, Manogue KR, Faist E, Abraham E, Andersson J, Andersson U, Molina PE, Abumrad NN, Sama A, Tracey KJ: HMG -1 as a late mediator of endotoxin lethality in mice Science 19 99,...
- 8
- 529
- 0
Báo cáo y học: "Ablation of atrial fibrillation with the Epicor system: a prospective observational trial to evaluate safety and efficacy and predictors of success" pptx
... computerized database and analyzed with a statistical package (STATISTICA; StatSoft, Inc) The descriptive summary of data included mean ± standard deviation and 95% confidence intervals for continuous ... switched to oral medication and maintained for months After months continuance of oral anticoagulation was determined on basis of the CHADS2 score In case of contraindications for amiodarone treatment, ... Medical Center Regensburg, Germany Received: January 2 010 Accepted: May 2 010 Published: May 2 010 11 12 13 14 15 16 17 18 Stroke prevention in atrial fibrillation investigators Stroke 19 97, 28 :11 01- 6...
- 6
- 480
- 0
Báo cáo khoa học: "Pneumothorax and mortality in the mechanically ventilated SARS patients: a prospective clinical study" ppsx
... statistical analysis H-KK made contributions to the collection, analysis and interpretation of data J- HW, C-SS and Y-CH made contributions to the design of the study and performed the statistical analysis ... limitations to our study Data were recorded once daily in individual isolation rooms and may have missed transient elevations in airway pressure/volume that could have led to alveolar disruption and pneumothorax ... l (during hospitalization) 15 .33 ± 4. 68 12 .93 ± 4 .10 0.26 Data are presented as mean ± standard deviation R 442 Critical Care Vol No Kao et al Figure cally ventilated SARS the probability of survival...
- 6
- 232
- 0
Báo cáo khoa học: " Antifactor Xa activity in critically ill patients receiving antithrombotic prophylaxis with standard dosages of certoparin: a prospective, clinical study" pptx
... the study and its coordination, and carried out bedside sampling and documentation DF conceived of the study, helped to perform statistical analysis, and contributed to the draft of the manuscript ... AJM conceived of the study protocol and participated in its design and coordination BEF participated in the study design and its coordination IL participated in the study design and its coordination ... of the study protocol, participated in its design and coordination, carried out bedside sampling and documentation, and helped to draft the manuscript VM and GL participated in the design of the...
- 8
- 296
- 0
Báo cáo y học: "Duration of salmeterol-induced bronchodilation in mechanically ventilated chronic obstructive pulmonary disease patients: a prospective clinical study" pot
... WA, Milic-Emili J: Flow and volume dependence of pulmonary mechanics in anaesthetized cats J Appl Physiol 19 88 , 64: 4 41 - 45 0 28 Fernandez A, Lazaro A, Garcia A, Aragon C, Cerda E: Bronchodilators ... salmeterol delivered by an MDI and a spacer device induced significant bronchodilation The duration of the observed bronchodilator effect was highly variable and unpredictable among patients This variability ... 3 .1 15 .8 ± 2. 8a 15 .3 ± 3. 1a 15 .1 ± 2. 9a 15 .0 ± 3. 1a 14 .9 ± 3. 2a 14 .9 ± 2. 8a 15 .0 ± 2. 8a 15 .2 ± 2. 7a 15 .5 ± 2. 6a 16 .0 ± 2.7 7 .1 ± 1. 6 6.2 ± 1. 7a 5.5 ± 1. 9a 5.2 ± 1. 8a 5.2 ± 1. 8a 5 .1 ± 1. 8a 5.1...
- 7
- 254
- 0
A study to indicate the importance of consumer based-brand equity on consumer perception of brand (a case study of fast food restaurants).pdf
... and Prasad and Dev (2000) also adopted four of Aaker (19 91) component i.e brand awareness, perceived quality, brand loyalty and brand association Yoo et al (2000) adopted three of Aaker (19 91) ... perceived qualities, brand loyalty, brand awareness, brand association and other propriety assets According to him, Brand loyalty has to with the level of devotion a consumer has to a brand Brand awareness ... Therefore MacDonald can be said to have a larger degree of dispersion of data around the mean than Max hamburger in those attributes Max hamburger had a larger standard deviation than MacDonald...
- 88
- 986
- 8
Tài liệu Báo cáo khoa học: Modulation of a-synuclein aggregation by dopamine in the presence of MPTP and its metabolite pptx
... (A and C) and MPP+ (B and D) were analysed by SDS ⁄ PAGE (A and B) on 5 15 % crosslinked polyacrylamide gel and western blotting (C and D) (A, B) Lane M, prestained molecular mass markers; lane ... aggregate The final concentration of the protein was adjusted to mgÆmL )1 ( 48 3 lm) and incubated at 37 °C [19 ] Aliquots were withdrawn at predefined time intervals The aggregation pattern was analysed ... required for dopaminergic neuron death induced by rotenone, MPP+, or paraquat Proc Natl Acad Sci USA 10 5, 15 136 15 1 41 14 Leong SL, Cappai R, Barnham KJ & Pham CL (2009) Modulation of alpha-synuclein...
- 11
- 754
- 0
Business water footprint accounting: A tool to assess how production of goods and services impacts on freshwater resources worldwide pdf
... 80 10 4 12 9 13 4 14 1 14 2 15 2 15 5 16 7 200 2 34 235 2 41 276 2 98 326 3 28 41 8 4 51 Revenues ($ millions) 99, 0 14 .7 79,9 78. 8 75 ,13 1.0 66 ,11 1.2 56, 944 .9 47 ,40 9.0 45 ,635.2 43 ,900.3 43 , 81 3 .8 41 , 249 .1 40 , 18 5.0 ... 37 ,40 6.0 32 ,43 8 .1 28, 350 .4 28, 275.5 27, 516 .0 24, 4 81 . 8 23 ,12 5.3 21, 81 9 .7 21, 7 54. 0 17 ,507.7 16 ,46 6 .4 Profits ($ millions) 2, 84 6 .2 3, 544 .9 1, 3 24. 9 1, 1 14 .9 1, 127.9 1, 750.6 1, 140 .7 936.0 1, 3 68. 9 49 2.9 ... livestock and livestock products A. K Chapagain and A. Y Hoekstra – July 2003 14 The water needed to have the Dutch drink coffee A. K Chapagain and A. Y Hoekstra – August 2003 15 The water needed to...
- 46
- 959
- 0
Báo cáo "Developing a bilateral input-output table in the case of Thailand and Vietnam: Methodology and applications " doc
... Thailand’s final demand and the remaining 18 .9% by Vietnam’s final demand Of the total labor income of US$57.2 billion, 70 .1% was induced by Thailand’s final demand and 29.9% by Vietnam’s final demand, ... 2000, 81 . 5% was induced by Thailand’s total final demand, broken down into: 37.9% by final consumption demand, 9 .4% by capital formation or investment demand and 34. 2% by its exports demand The ... remaining 18 .5% of total production was induced by Vietnam’s total final demand, broken down into: 8 .1% by its final consumption demand, 3 .4% by capital formation and 6.9% by exports demand It...
- 13
- 562
- 0
Báo cáo khoa học: "A Unification-based Approach to Morpho-syntactic Parsing of Agglutinative and Other (Highly) Inflectional Languages" doc
... Deriv=Adv Deg=Comp DerSuper Allom=i Lex=NonBase ly Cat=-Nom Subcat=Adj Deriv=Adv Allom=i Base i -> .y cate~or~ [ADJ] [ADH [ADV] Lex=NonBase way of handling compounding and adequate handling of derivational ... Processing: 41 - 49 (19 98) Bybee, J L Morphology A Study of the Relation between Meaning and Form Benjamins, Amsterdam (19 85 ) Calder, J Paradigmatic Morphology Proceedings of 4th Conference of EACL 89 : 58- 65 ... returned Choice is a task of either the end-user or a disambiguator module that is based on the context of the word the big bad wolves Morphological analysis: the[ Det] big[Adj] bad[Adj] wolf[N]=wolve+s[PL]...
- 8
- 404
- 0
Báo cáo khoa học: "A Unification-based Approach to Morpho-syntactic Parsing of Agglutinative and Other (Highly) Inflectional Languages" ppt
... Deriv=Adv Deg=Comp DerSuper Allom=i Lex=NonBase ly Cat=-Nom Subcat=Adj Deriv=Adv Allom=i Base i -> .y cate~or~ [ADJ] [ADH [ADV] Lex=NonBase way of handling compounding and adequate handling of derivational ... Processing: 41 - 49 (19 98) Bybee, J L Morphology A Study of the Relation between Meaning and Form Benjamins, Amsterdam (19 85 ) Calder, J Paradigmatic Morphology Proceedings of 4th Conference of EACL 89 : 58- 65 ... returned Choice is a task of either the end-user or a disambiguator module that is based on the context of the word the big bad wolves Morphological analysis: the[ Det] big[Adj] bad[Adj] wolf[N]=wolve+s[PL]...
- 8
- 412
- 0
Báo cáo toán học: "A calmodulin inhibitor, W-7 influences the effect of cyclic adenosine 3'''', 5''''-monophosphate signaling on ligninolytic enzyme gene expression in Phanerochaete chrysosporium" pot
... incubation for 48 h under air, mM veratryl alcohol was added as a stabilizer of LiP (Cancel et al 19 93), and the air in the headspace of the flask was replaced with O2 gas every 24 h (Kirk and Farrell ... determination of the internal standard (Fig 4) Drugs were added into 48 h culture, and total RNA was extracted from each culture at 24 h after the drug addition Each real-time RT-PCRs was performed ... (i) an initial denaturation step at 95°C for 10 s and (ii) 40 cycles, with each cycle consisting of denaturation at 95°C for s and annealing and elongation at 60°C for 30 s The standard curve of...
- 34
- 397
- 0
báo cáo hóa học:" A calmodulin inhibitor, W-7 influences the effect of cyclic adenosine 3’, 5’-monophosphate signaling on ligninolytic enzyme gene expression in Phanerochaete chrysosporium" pot
... b a a a aa b a c a a a a bc aa b b ab a a c abc c abc abc abc Figure Absolute quantities of the lip, mnp, and cam gene transcripts Each drug was added after 48 h incubation, and mRNA was extracted ... the presence of various drugs Each chemical was added after 48 h incubation Effect on LiP activity (top panel) and MnP activity (bottom panel) under each condition Error bars show the standard deviation ... a packed-bed bioreactor J Hazard Mater 16 9 :88 –93 doi :10 .10 16 /j. jhazmat .2009. 03.070 Shen H-M, Yang C-F, Ding W-X, Liu J, Ong C-N (20 01) Superoxide radical-initiated apoptotic signalling pathway...
- 9
- 398
- 0
Báo cáo hóa học: "A calmodulin inhibitor, W-7 influences the effect of cyclic adenosine 3’, 5’-monophosphate signaling on ligninolytic enzyme gene expression in Phanerochaete chrysosporium" pptx
... b a a a aa b a c a a a a bc aa b b ab a a c abc c abc abc abc Figure Absolute quantities of the lip, mnp, and cam gene transcripts Each drug was added after 48 h incubation, and mRNA was extracted ... the presence of various drugs Each chemical was added after 48 h incubation Effect on LiP activity (top panel) and MnP activity (bottom panel) under each condition Error bars show the standard deviation ... a packed-bed bioreactor J Hazard Mater 16 9 :88 –93 doi :10 .10 16 /j. jhazmat .2009. 03.070 Shen H-M, Yang C-F, Ding W-X, Liu J, Ong C-N (20 01) Superoxide radical-initiated apoptotic signalling pathway...
- 9
- 438
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008