cd4 t regulatory cells and modulation of undesired immune responses
báo cáo hóa học:" Generation in vivo of peptide-specific cytotoxic T cells and presence of regulatory T cells during vaccination with hTERT (class I and II) peptide-pulsed DCs" pot
Ngày tải lên :
18/06/2014, 15:20
... Cytotoxicity of In Vivo Generated T Cells T2 -cytotoxicity Cumulative cytotoxicity results for all patient samples show that after two cycles of vaccination (the time point associated with the ... production of T cells that not recognize tumour cells in vivo based on this epitope [67-69] In contrast to these studies, the ability of our vaccination strategy to generate tetramer+ CD8 +T cells ... course of tetramer responses to vaccination in a representative patient (N010) who generated equivalent tetramer+CD8 +T cell responses to DCT and DCTI D Flowcytometry of representative tetramer...
- 23
- 439
- 0
Báo cáo y học: " Lentiviral transduction of Tar Decoy and CCR5 ribozyme into CD34+ progenitor cells and derivation of HIV-1 resistant T cells and macrophages" pdf
Ngày tải lên :
10/08/2014, 05:20
... Forward Tar: 5'-GCAATGATGTCGTAATTTGC and 2, Reverse Tar: 5'-CTTGCTCAGTAAGAATTTTCGTC HIV-1 infection of thymocytes Thymocytes derived from thy/liv grafts of SCID-hu mice were sorted by FACS to enrich ... region of the transactivation response element (Tar), present at the 5'-end of all HIV-1 transcripts [1] In the absence of Tat, only short ineffective transcripts are generated Tat is also known to ... selectively alter maturation of different cell subsets Our results showed the presence of all three thymocyte subsets in grafts reconstituted with transduced cells when compared to control cells Additionally,...
- 11
- 264
- 0
Báo cáo y học: " FoxP3 and Bcl-xL cooperatively promote regulatory T cell persistence and prevention of arthritis development" ppt
Ngày tải lên :
12/08/2014, 12:20
... for the treatment of established autoimmune disease Conclusions The results of the present study demonstrate that FoxP3 and Bcl-xL can cooperatively promote the differentiation and persistence of ... augmenting the differentiation and persistence of Tregs Most significantly, the co-introduction of these molecules into CD4+ T cells resulted in their ability to significantly block the development ... Treg phenotype to conventional T cells, allowing these Tregs to be used therapeutically for the prevention of autoimmunity and transplant rejection Several groups have investigated the potential...
- 11
- 236
- 0
Báo cáo y học: " CD4+CD25+ T regulatory cells from FIV+ cats induce a unique anergic profile in CD8+ lymphocyte targets" pps
Ngày tải lên :
13/08/2014, 01:20
... drafted the manuscript WT assisted with study design, data interpretation and manuscript revisions MT assisted with study design, data interpretation and manuscript revisions All authors read and ... CD8+ T lymphocyte targets without these cells exhibiting regulatory function; however, the function of Foxp3 in these target cells in unclear [46-48] Further investigation is needed to clarify the ... subset of these cells Foxp3 is a forkhead transcription factor which binds DNA adjacent to NFAT sites and is essential to the development of CD4 + CD25 + regulatory T cells [41-43] We and others...
- 10
- 224
- 0
Báo cáo y học: "T regulatory cells: an overview and intervention techniques to modulate allergy outcome" ppsx
Ngày tải lên :
13/08/2014, 13:22
... ability [6,8,9] Thus, the current understanding is that the natural T regulatory cells are cells that possess the CD4+ CD25+Foxp3+ phenotype Development and homeostasis of the T regulatory cell The ... mast cells [35] It also prevents the secretion of IL-9 and IL-3 by the Th2 cells, thereby preventing the mucus production in the lung The Tregs also inhibit the function of the Th1 and Th2 CD4+ T ... Further studies showed that the Foxp3 was largely expressed in CD4+ CD25 +T cells; and retroviral transduction of conventional CD4+ T cells with Foxp3 converted them to regulatory T cells with...
- 8
- 332
- 0
Tài liệu SEXUAL HEALTH EDUCATION A T SCHOOL AND A T HOME: ATTITUDES AND EXPERIENCES OF NEW BRUNSWICK PARENTS pptx
Ngày tải lên :
14/02/2014, 14:20
... used to evaluate parents’ responses to these items One of the authors reviewed all responses to each of these items and then read and reread the responses until patterns emerged These patterns ... envelopes, to students in their class, with the request that they take them home to be filled out by their parents Surveys were returned to the school with the child, and then returned to the researchers ... school Theme #2: Quality of teaching Some parents mentioned the teaching methods used for SHE and the importance of the quality of teaching They indicated that they want their children to have...
- 13
- 473
- 0
Therapeutic ultrasound as a potential male contraceptive: power, frequency and temperature required to deplete rat testes of meiotic cells and epididymides of sperm determined using a commercially available system doc
Ngày tải lên :
05/03/2014, 17:20
... an attempt to bring post-treatment sperm counts closer to zero, the effect of two consecutive treatments separated by two days were tested [Study 1, Table 2] Two weeks after treatment, total ... initiated one minute prior to the start of ultrasound treatment and continued for one minute after the conclusion of ultrasound treatment to record pre- and posttreatment baseline temperatures ... re-circulated at 37°C during ultrasound treatments and at 45°C for the wet heat control The rotation frequency of the transducer correlated with temperature fluctuations at the site of the thermal...
- 15
- 967
- 0
Báo cáo khoa học: Helicobacter pylori single-stranded DNA binding protein – functional characterization and modulation of H. pylori DnaB helicase activity pptx
Ngày tải lên :
30/03/2014, 02:20
... HpDnaB that allows their coprecipitation Association of HpDnaB and HpSSB at high salt concentration indicates that these two proteins may have an affinity towards each other To substantiate this ... from PRSET-BmCherry [39] at the SacI–XhoI site [HpSSB full length forward BamHI, 5¢-CG GGATCCATGTTTAATAAAGTGA TTATGG-3¢; HpSSB full length reverse BamHI,5¢CG GG ATCCCTTCATCAATATTGATTTCAGG-3¢; ... protein–protein interaction that is central to the DNA replication machinery in prokaryotes To the best of our knowledge, this is the first probe into the coccoid 520 stage demonstrating its distinction...
- 13
- 438
- 0
Báo cáo khoa học: Poneratoxin, a neurotoxin from ant venom Structure and expression in insect cells and construction of a bio-insecticide pot
Ngày tải lên :
30/03/2014, 13:20
... [11] Two oligonucleotides: forward 5¢-GATCCATGTTTCTTCCGCTTCTGATCCTTGGCT CTCTTCTGATGAC-3¢ and reverse 5¢-CGGCGTCATCA GAAGAGAGCCAAGGATCAGAAGCGGAAGAAA CATG-3¢, were used to synthesize the N-terminal ... fragment of the poneratoxin gene Two others: forward 5¢-GCC GCCCGTGATACAGGCGATCCACGATGCGCAGA GGTAGTAATGAG-3¢ and reverse 5¢-AATTCTCATTA CTACCTCTGCGCATCGTGGATCGCCTGTATCAC GGG-3¢ were used to construct ... poneratoxin gene (number 4): 5¢-TCTGCCTTTGCATGCTTTCTTCCGCTTCTG-3¢ Fig Expression of recombinant poneratoxin in the baculovirus system and its purification (A) Total cell extract of poneratoxin-expressing...
- 10
- 696
- 0
Báo cáo khoa học: " Immunosuppression by T regulatory cells in cows infected with Staphylococcal superantigen" ppt
Ngày tải lên :
07/08/2014, 18:21
... ,senikotyc fo tnemevlovni tceridni eht tub ,sisab tcatnoc llec-llec htiw detaicossa ylniam era seitivitca ehT ]51,3[ sesnopser yrotammalfni detaidem llec -T dna ytinummi evitcetorp ,ytinummiotua lortnoc ... setycohpmyl T +8DC detavitca esoht ot elbatubirtta eb yam tluser sihT )MWP( negotim deewekop dna A noC yb detalumits erew LBP nehw ro namuh ni detibihni ton saw noitarefilorp etycohpmyl T +4DC detavitca ... rT larutan htiw tcatnoc llec-llec ro noitalumitsoc fo ecnesba eht ni negitna fo noitatneserp etairporppani ,senikotyc evisserppus ,secrof yrotaluger cisnirtxe yb detomorp eb yam sllec rT evitpada...
- 4
- 278
- 0
Báo cáo y học: "T-cell senescence and contraction of T-cell repertoire diversity – catalysts of autoimmunity and chronic inflammation" pdf
Ngày tải lên :
09/08/2014, 01:23
... shown that these autoimmune manifestations can be prevented by naive T cells that lack any features of regulatory cells but that have the potential of homeostatic expansion Clonal competition ... that T- cell homeostasis is not intact in patients with rheumatoid arthritis (RA) came from the observation that these patients carried large clonally expanded populations of CD4+ and CD8+ T cells ... Contraction of diversity in the naive T- cell compartment could not be attributed to contamination of memory cells that reverted to the CD45 RA phenotype Based on sequence analysis, the distinction...
- 10
- 412
- 0
Báo cáo y học: "Obstructive apneas induce early activation of mesenchymal stem cells and enhancement of endothelial wound healing" ppsx
Ngày tải lên :
12/08/2014, 11:22
... out by means of the Student's t- test (when applicable) or the MannWhitney test Statistical significance was established as p < 0.05 Results The serum of apneic rats increased the motility of ... Accordingly, to our knowledge this is the first work studying how the stimuli characterizing OSA activate MSC responses and thus potentially contribute to the response to inflammation and the enhancement ... from the effects of the other potentially important stimuli also experienced by these cells in OSA patients, such as intermittent hypoxia due to the recurrent changes in arterial oxygen saturation...
- 7
- 282
- 0
Báo cáo y học: "Stem cells and repair of lung injuries" doc
Ngày tải lên :
12/08/2014, 18:21
... impenetrable [20,21,8] There are a few controversial reports that adult stem cells from outside the bone marrow may reconstitute the hematopoietic system, but most of the evidence flows in the other ... proliferation, migration, differentiation, function, death, and removal are tightly regulated to maintain tissue homeostasis Cell compartments in the lung and functional integration Figure Traditional ... epithelial and gland cells and type II pneumocytes of host origin were reported in one study of lung allografts [35], but not another [36] After bone marrow transplantation, epithelial cells of...
- 9
- 273
- 0
Báo cáo y học: "Bench-to-bedside review: Biotrauma and modulation of the innate immune response" pps
Ngày tải lên :
12/08/2014, 20:21
... system and that, in turn, the innate immune system may sensitize the lungs to the effects of mechanical ventilation This ‘two-hit hypothesis’ has permeated the literature on VILI and purported ensuing ... modest dose (5 mg/kg) and did not result in overt ALI before initiation of the ventilation protocol; and the mechanical ventilation protocol used levels of Vt that did not lead to disruption of the ... reaction, ultimately leading to MODS and death The central concept is that mediators originate in the lung and gain access to the circulation where they potentially can exert detrimental effects...
- 8
- 200
- 0
Báo cáo y học: " Reduced CD4 T cell activation and in vitro susceptibility to HIV-1 infection in exposed uninfected Central Africans" pptx
Ngày tải lên :
13/08/2014, 09:20
... DS-A and GP conceived of the study and contributed to its experimental design and coordination GB and VM participated in the design and coordination of the study LC and AF performed the statistical ... T cell activation markers, with a stronger effect on CD8 than on CD4 T cell activation [4,5] A pattern of immune activation, including an increase of activated T cell subsets and of the HIV-1 ... evaluate the impact of the baseline activation of PBMC on their suscep- tibility to infection, we inoculated PBMC with the virus without any previous exogenous stimulation (infection before activation,...
- 9
- 238
- 0
Microencapsulation of clostridium acetobutylicum cells and utilisation of samanea saman leaves for the production of biobutanol
Ngày tải lên :
08/09/2015, 18:41
... the resistant structure of any lignocellulosic substrate, pretreatment of the substrate is prerequisite The pretreatment methods investigated were milling, hydrothermal treatment and dilute acid ... Factors affecting the gel strength and stability, and consequently the activity of the encapsulated cells include the type of alginate, alginate concentration, cross-linking agent concentration ... are first separated using a filter and then the cells are returned to the fermentor (Tashiro et al., 2005) The separation of the cells from the toxic metabolic products in the fermentation medium...
- 220
- 428
- 0
Báo cáo sinh học: "Parasite immunomodulation and polymorphisms of the immune system" ppsx
Ngày tải lên :
06/08/2014, 19:20
... Pathogen killing Allergy Autoimmunity Effector T cell subsets (Th1, Th2, Th17…) Treg Immunomodulation Susceptibility to infection Mostly regulatory polymorphisms controlling quantitative effects ... gene-parasite) interactions can contribute to the development of damaging immune reactions in autoimmunity and allergy The identification of precise genetic variants controlling both parasite susceptibility ... exceptionally susceptible to either infection or pathology, and a deeper understanding of the intimate co-evolution of pathogens and the immune system 10 11 12 13 14 Acknowledgements The author’s research...
- 4
- 386
- 1
Báo cáo y học: "Modulation of humoral immune response to oral BCG vaccination by Mycobacterium bovis BCG Moreau Rio de Janeiro (RDJ) in healthy adults" ppsx
Ngày tải lên :
11/08/2014, 10:23
... that tuberculosis affects an important mucosal site, the respiratory tract, the potential use of oral booster vaccination in immunisation programmes is of interest Subjects who were not boosted ... proliferation and cytokine measurement assays, participated in the study design and wrote the manuscript MBOS and LRCB recruited volunteers MBOS and RTP participated in the study design and participated ... objective of inducing protective mucosal and systemic immunity against initial infection and systemic progression This study demonstrates, for the first time, the immune response to oral immunisation...
- 6
- 302
- 0
Basic immunology functions and disorders of the immune system
Ngày tải lên :
04/08/2016, 15:18
... respond to other cytokines secreted by APCs The combination of signals (antigen, costimulation and cytokines) stimulates the proliferation of the T cells and their differentiation into effector T cells ... Different subsets of T cells differentiate into effector cells with distinct functional properties Naive CD4+ T cells become helper T cells, and naive CD8+ T cells become CTLs The helper T cells and ... into the circulation The net result of these changes is that differentiated effector T cells leave the lymph nodes and enter the circulation These effector cells preferentially migrate into the...
- 321
- 727
- 0
Báo cáo hóa học: " Elicitation of protective immune responses using a bivalent H5N1 VLP vaccine" pot
Ngày tải lên :
20/06/2014, 01:20
... elicited HAI antibodies that inhibited the agglutination of horse RBCs by both the clade and clade isolates that were homologous to the vaccines (Table 1) These titers were statistically similar to ... elicit immune responses and protection at low doses (HA content) and without the use of an exogenous adjuvant [2], both of which potentially reduce reactogenicity of the vaccine Recombinant VLP ... like to thank Rick Bright, and Terrence Tumpey for helpful comments and discussions The authors thank the Indonesian Ministry of Health and Vietnam Ministry of Health and Center for Disease Control...
- 9
- 219
- 0