cd4 t lymphocyte cells and cd8 t cytotoxic cells
Báo cáo hóa học: " Decreased level of recent thymic emigrants in CD4+ and CD8+T cells from CML patients" pdf
Ngày tải lên :
18/06/2014, 16:20
... cloned in to the EcoRV restriction site of the TOPO TA Vector (Invitrogen, Groning, The Netherlands) Based on the DNA concentration, measured by spectrophotometry and confirmed by a quantitative gel ... CD3 +cells in the analyzed samples Furthermore, we analyzed sjTRECs in sorted CD4+ and CD8+ T cells This is the most sensitive and accurate method for quantitation of naïve T- cells It allows also the comparison ... Germany) After CD4+ and CD8+ T cells sorting, the purity was determined by indirect immune fluorescent analysis The positive cells were around 95% to 97% DNA extraction Total DNA from distinct cell...
- 8
- 367
- 0
Báo cáo y học: "Heterogeneity of CD4+ and CD8+ memory T cells in localized and generalized Wegener’s granulomatosis." potx
Ngày tải lên :
09/08/2014, 01:21
... on CD4+ CD45RO+ and CD8 +CD45 RO+ and also on CD4+ CD45RA+ and CD8 +CD45 RA+ T cells indicates activation and the potential to respond to chemotactic gradients in inflammatory areas, which is consistent ... reported to distinguish effector cells from naive T cells within the CD8 +CD45 RA+ T cell population [21] However, Wills et al [22] demonstrated that cytomegalovirus-specific T cells, that is, antigen-experienced ... infection and interferon-α therapy [33] The present study shows that not only ‘classical’ chemokine-receptor-bearing CD45 RO+ T cells, but also CD45 RA+ ‘revertants’ within the CD4+ and CD8+ T cell...
- 7
- 354
- 0
Báo cáo y học: " Antibody microarray analysis of cell surface antigens on CD4+ and CD8+ T cells from HIV+ individuals correlates with disease stages" ppt
Ngày tải lên :
13/08/2014, 05:22
... CD4+ T cells Composite dot scan patterns of antibody binding for CD4+ T cells Half of a duplicate array was shown with the alignment dots "A" at left, top and bottom Alignment dots are a mixture ... findings, together with ours, support the hypothesis that the CD8+ T cells from LNTP may have stronger cytotoxic activity than those from other HIV+ individuals CD16 expression on CD8+ T cells in ... Learmont J, Cooper DA, Sullivan JS: Effect of long-term infection with nef-defective attenuated HIV type on CD4+ and CD8+ T lymphocytes: increased CD45 RO +CD4+ T lymphocytes and limited activation...
- 13
- 289
- 0
Báo cáo y học: "Isolated receptor binding domains of HTLV-1 and HTLV-2 envelopes bind Glut-1 on activated CD4+ and CD8+ T cells" pot
Ngày tải lên :
13/08/2014, 09:21
... not recognize endogenous Glut-1 on these cells Notably, the ability of HTLV-1 and HTLV-2 derived RBDs to bind to parental and transfected 29 3T cells correlated with the data obtained using the ... not shown) Thus, mAb1418 staining is significantly decreased following optimal TCR stimulation of CD8 T lymphocytes These data are in complete contradiction with the longstanding notions that; ... TCR stimulation results in Glut-1 expression and concomitant glucose uptake in CD4 and CD8 lymphocytes: Induction of H1RBD and H2RBD binding CD4+ and CD8+ T lymphocytes were isolated by negative...
- 9
- 283
- 0
Báo cáo y học: "Resistance to IL-10 inhibition of interferon gamma production and expression of suppressor of cytokine signaling 1 in CD4+ T cells from patients with rheumatoid arthritis" ppsx
Ngày tải lên :
09/08/2014, 01:24
... phosphorylation and activation of the latent transcription factors R571 Arthritis Research & Therapy Vol No Yamana et al Figure (a) control RA HC p-Tyr-STAT3 HC STAT3 p-Tyr-STAT1 STAT1 (%pSTAT3/STAT3) ... p-Tyr-STAT3 STAT3 IL-10 (ng/ml) 10 HC PB RA ST CD4+ T cells CD4+ T cells of IL-10-mediated (RA) STAT3 in CD4 T cells from (a)transcription (STAT) and from healthy controls (HC) patients with ... normal CD4+ T cells These findings indicate that CD4+ T cells become resistant to the inhibitory effect of IL-10 before migration into the inflamed ST, and suggest that this resistance may be attributable...
- 11
- 604
- 0
Báo cáo khoa học: "Density of CD4(+) and CD8(+) T lymphocytes in biopsy samples can be a predictor of pathological response to chemoradiotherapy (CRT) for rectal cancer" ppt
Ngày tải lên :
09/08/2014, 09:20
... with tumor response to CRT [13] This finding is in line with the data in this study, and suggested that the maintenance of circulating lymphocytes number can recruit many anti-tumor lymphocytes ... chemotherapy [17] However, in our literature search, there are no report to evaluate the correlation between TIL and radiosensitivity, and this is the first one to show the direct link between the ... density of T cells infiltrating in solid tumor and response to CRT On the other hand, Grabenbauer et al previously reported that tumor-infiltrating CD3(+) T cells, especially granzymeB(+) CD8( +) T...
- 6
- 371
- 0
Báo cáo y học: "Evidence that Gag facilitates HIV-1 envelope association both in GPI-enriched plasma membrane and detergent resistant membranes and facilitates envelope incorporation onto virions in primary CD4+ T cells" doc
Ngày tải lên :
12/08/2014, 04:21
... respectively As shown in Figure 2, L30E mutation in Gag restricted envelope association with DRM fractions of CD4+ T cells in contrast to the wild type Our results were further substantiated by the ... infection with virus stocks Primary CD4+ T cells were infected with equal infectivity titers of VSV-G pseudotyped pNL4.3 WT and pNL4.3 L30E viruses and the cell lysates made from CD4+ T cells ... also known to be associated with DRM [38] Our data showed that abrogation of Gag-Env interaction down modulated envelope transport into CD59 positive compartment in primary CD4+ T cells and also...
- 5
- 259
- 0
Báo cáo y học: "Defective response of CD4+ T cells to retinoic acid and TGFb in systemic lupus erythematosus" ppt
Ngày tải lên :
12/08/2014, 17:22
... albeit incomplete, and have concluded that these cells represent an attempt to control active autoimmune activation [14] The size of the Treg compartment results from the combined contribution ... indicating that treatment was not the main cause for low CD4+ T cell counts However, treatment was associated with a further decrease in the percentage of CD4 + T cells (untreated patients: 11.51 ... suggested that CD25- Tregs correspond to activated T cells without suppressive activity [13] The other group working with treated patients has shown that the CD25- Tregs retain a suppressive function,...
- 15
- 320
- 0
Báo cáo y học: "TLR2 and TLR4 triggering exerts contrasting effects with regard to HIV-1 infection of human dendritic cells and subsequent virus transfer to CD4+ T cells" docx
Ngày tải lên :
12/08/2014, 23:20
... the up-regulatory effect of NF-κB with regard to HIV-1 transcription and the potent induction of this transactivator by TLR2 stimulation, we thought that the TLR2-mediated augmentation in de novo ... efficient than TLR5, and stimulations as evidenced by the higher production of IL-6, TNF-α and RANTES Knowing that TLR4 stimulation can activate pathways resulting in both NF-κB activation and secretion ... monitored using the fluorescent cytotoxic MTS assay Cell viability was not affected by the studied TLR ligands used at concentrations known to modulate the DC-mediated transfer of HIV-1 (data not...
- 16
- 288
- 0
Báo cáo y học: "Genome-wide analysis of primary CD4+ and CD8+ T cell transcriptomes shows evidence for a network of enriched pathways associated with HIV disease" pot
Ngày tải lên :
13/08/2014, 01:20
... muscle, aorta ACTA2L ctgttccagccatccttcat ACTA2R tcatgatgctgttgtaggtggt VIRvsLTNP CD8 4.3 2.8 PSMB2 NM_002794.3 proteasome subunit, beta type, PSMB2L agagggcagtggaactcctt PSMB2R gaaggttggcagattcagga ... V1 subunit D ATP6V1DL ttttcactagctgaagccaagtt ATP6V1DR gcgctttattgacattttggat VIRvsLTNP CD8 2.0 2.8 BAG3 cagccagataaacagtgtggac BAG3R agaggcagctggagactgg VIRvsLTNP CD8 -1.5 Wu et al Retrovirology ... C1QCL aaggatgggtacgacggact C1QCR ttctgccctttgggtcct VIRvsLTNP CD4 7.3 4.4 SERPING1L ctccttacccaggtcctgct SERPING1R ggatgctctccaggtttgtt VIRvsLTNP CD4 5.3 2.8 SERPING1 NM_000062.2 serpin peptidase...
- 21
- 376
- 0
Báo cáo y học: "Effects of naturally-arising HIV Nef mutations on cytotoxic T lymphocyte recognition and Nef’s functionality in primary macrophage" pptx
Ngày tải lên :
13/08/2014, 01:21
... CTL cytotoxic activity toward MDMs infected with 7 5T, 85F, and TF variant viruses The A24-Nef CTLs showed the most potent activity toward MDMs infected with either the 7 5T or TF variant viruses; ... viruses; whereas their cytotoxic activity was less potent toward MDMs infected with either the wt or the 85F mutant virus (Figure 4) These data suggest that the diminished HLA-I down-regulation (i.e., ... activities in primary CD4+ T cells infected with a CXCR4tropic virus in the previous study [13] In addition, the 7 5T mutation, located outside the VY8 epitope, reduced the cytolytic activity...
- 7
- 271
- 0
Báo cáo y học: " Effects of prostratin on Cyclin T1/P-TEFb function and the gene expression profile in primary resting CD4+ T cells" doc
Ngày tải lên :
13/08/2014, 09:20
... up-regulates CDK9 kinase activity, which is likely to contribute to the level of transcriptional elongation in prostratin-treated cells The amounts of resting and prostratin-treated CD4+ T cells that ... known to associate with P-TEFb and repress catalytic activity in vitro, are affected by prostratin treatment For detection of total 7SK levels, we carried out Northern blots of total RNA isolated ... infect resting CD4+ T cell In contrast to the virus expressing a functional Tat protein, the Tat- virus infections did not show a significant stimulatory effect when treated with prostratin In...
- 14
- 283
- 0
Báo cáo y học: " Persistent resistance to HIV-1 infection in CD4 T cells from exposed uninfected Vietnamese individuals is mediated by entry and post-entry blocks" potx
Ngày tải lên :
13/08/2014, 09:20
... suggesting that the mechanisms of resistance in these subjects not depend on exposure to the virus but rather might be linked to constitutive factors It is noteworthy in this respect that heterozygous ... reverse transcription, are impaired in W276 CD4 T cells Note that W276 CD4 T cells were readily activated by PHA (>95% of cells were CD25+ at the time of challenge) thus discarding that the restriction ... cells and found that both entry and post-entry steps of HIV-1 replication could be affected Interestingly, the restriction in one of these subjects also affected other lentiviruses In addition, the...
- 12
- 377
- 0
Báo cáo khoa học: GRAIL: a unique mediator of CD4 T-lymphocyte unresponsiveness ppt
Ngày tải lên :
15/03/2014, 00:20
... target proteins to regulate their stability, activity and localization Post-translational ubiquitination can result in proteolytic degradation as well as nonproteolytic outcomes that regulate a ... required to characterize the distribution of the varied isoforms of Otub in CD4+ T- cell subsets and the activation conditions that lead to alterations in the balance between Otub1 and Otub 1-ARF ... leads to Akt and mTOR activation, Otub translation, de-ubiquitination of ubiquitinated USP8, and subsequent degradation of GRAIL that permits T- cell proliferation In the absence of costimulation...
- 12
- 337
- 0
Xác định sơ bộ giá trị phần trăm, tuyệt đối của tiêu chuẩn quần thể Lympho (T CD3, T CD4, T CD8, B, NK) ở nhóm người bình thường tại thành phố Hồ Chí Minh bằng máy Fascalibur docx
Ngày tải lên :
25/03/2014, 03:22
... CD4, T CD8, B, NK) in the peripheral blood of healthy adults donors This reference ranges is used like target values for the patients at Pasteur Institute-HCMC and then compare the results with those ... Ngoại trừ TCD8, TCD4/TCD8 có p > 0,05 t c khác bi t trung bình hai nhóm dân số Trong TCD3, TCD4, CD19 có khác bi t (p < 0,05) với t lệ thấp nhóm dân số TP.HCM T ng t với NK có khác bi t (p < ... Summary LYMPHOCYTE SUBPOPULATION IN HEALTHY ADULTS DONORS OF HO CHI MINH CITY VIET NAM The primary objective of this study was to establish reference ranges for the lymphocyte subsets (T CD3, T CD4, ...
- 6
- 978
- 0
báo cáo hóa học:" Regulatory activity of azabisphosphonate-capped dendrimers on human CD4+ T cell proliferation enhances ex-vivo expansion of NK cells from PBMCs for immunotherapy" potx
Ngày tải lên :
18/06/2014, 15:20
... NK cells initially-obtained their name due to their natural cytotoxicity against tumor cells requiring no prior sensitization, unlike T cells [4] It is well established that the cytotoxicity ... also cytotoxic against the K562 cell line and that 3a-G1 doesn 't affect their cytotoxicity when compared with untreated cells [see Additional file 1] Contrary to expectation, we could not demonstrate ... interacts with CD4+ T cells We believe that this interaction might drive the inhibition of CD4+ T cell proliferation observed not only among PBMCs but also when pure CD4+ T cells were stimulated...
- 13
- 404
- 0
báo cáo hóa học:" Metabolic and anthropometric parameters contribute to ART-mediated CD4+ T cell recovery in HIV-1-infected individuals: an observational study" potx
Ngày tải lên :
20/06/2014, 08:20
... reconstitution that includes pre-ART viral, immune activation and CD4 + T cell counts The present study followed a cohort of ART-naïve, HIV-infected South African subjects We demonstrate that metabolic ... participants as per University of the Witwatersrand Ethics Committee- and Wistar Institute Institutional Review Board-approved study protocol Adiposity measurements Baseline height, weight and anthropometric ... supervised the statistical analysis, and contributed to data discussion and manuscript preparation CF was responsible for clinical coordination and patient interaction, and contributed to data discussion...
- 9
- 469
- 0
Báo cáo y học: "Differentiation of naive CD4+ T cells towards T helper 2 cells is not impaired in rheumatoid arthritis patients" pps
Ngày tải lên :
09/08/2014, 01:23
... activity [17,20,21] Together these data suggest that RA patients may benefit from therapies aimed at the regulation of the Th cell balance towards Th2 cell activity It also implies that intrinsic ... RA patients than for healthy controls Although we show that IL-7, and in particular the combination of IL-7 and IL-4, increased Th2 activity rather than Th1 activity of naive CD4+ T cells, this ... contribute to this relatively enhanced peripheral Th2 activity in RA patients compared to healthy controls The reduced capacity of Th2 cells to migrate to the arthritic sites could subsequently...
- 8
- 269
- 0
Báo cáo y học: "The p38 mitogen-activated protein kinase signaling cascade in CD4 T cells" docx
Ngày tải lên :
09/08/2014, 07:20
... after the stimulation of the TCR and CD28 [100] The importance of mRNA stability for the effector functions of T cells has been demonstrated in two different mouse strains in which the Th1 and ... after stimulation of the TCR that is essential for activation of the MAPK signal cascade is the recruitment of linker for activation of T cells (LAT) and the activation of guanine nucleotide exchange ... derived from atopic asthmatic patients partly inhibited the expression of IL-5 but did not alter that of IL-4 [68] Together, these data clearly indicate that the role of p38 MAPK in Th2 cytokine expression...
- 11
- 413
- 0
Báo cáo y học: "Are CD4+CD25-Foxp3+ cells in untreated new-onset lupus patients regulatory T cells" doc
Ngày tải lên :
09/08/2014, 14:22
... patients correlated with disease activity and that the cell number significantly decreased after glucocorticoid treatment [2] Whether these cells are Tregs or activated Teffs remains to be determined ... declare that they have no competing interests Authors' contributions HY and WZ developed the study, analyzed the data, and drafted the manuscript LZ and YL participated in the data collection, ... in a heterodimeric complex with TSLP receptor [15] TSLP-activated dendritic cells might participate in the homeostatic maintenance of CD4+ and development of Tregs in thymus [16] In this study,...
- 9
- 373
- 0