0

cd4 t cells in the spleens of ad5 il17a transduced mice

Báo cáo y học:

Báo cáo y học: " Pathogenic effect of interleukin-17A in induction of Sjögren’s syndrome-like disease using adenovirus-mediated gene transfer" docx

Báo cáo khoa học

... differences in the cellular composition of the infiltrations between mice administered Ad5- IL17A at an early or late stage At time of euthanasia, C57BL/6J mice treated with Ad5- IL17A vector at wks of ... leukocyte infiltration in the exocrine glands is often observed at these ages [32,33] Thus, it is important to examine the role of IL17A in the development of SS prior and post to any pathophysiological ... secreting CD4+ T cells that persisted at least 19 wks for mice treated at wks of age and 11 wks for mice treated at 16 wks of age These observations indicated that the Ad5 vector effect was longer than...
  • 11
  • 276
  • 0
Báo cáo y học:

Báo cáo y học: " Attenuated allergic airway hyperresponsiveness in C57BL/6 mice is associated with enhanced surfactant protein (SP)-D production following allergic sensitization" pdf

Báo cáo khoa học

... To that end, it is of interest that analyses of the murine IL-9 gene identified a genetic defect at the IL-9 locus in C57BL/6 mice [2] To investigate the association of BAL SP-D levels with the ... http://respiratory-research.com/content/4/1/15 Authors' contributions ENA carried out the surfactant protein analysis and analyzed the data MFB participated in the design of the study and contributed to the ... treatment protected against mortality and inhibited the immunoglobulin, eosinophil and Th2 cytokines associated with this model of fungal infection [35,36] Th2 cytokine levels in the BAL fluid of...
  • 12
  • 210
  • 0
Báo cáo khoa học: b3-Adrenoceptor knockout in C57BL/6J mice depresses the occurrence of brown adipocytes in white fat pptx

Báo cáo khoa học: b3-Adrenoceptor knockout in C57BL/6J mice depresses the occurrence of brown adipocytes in white fat pptx

Báo cáo khoa học

... that the brown adipocytelike cells present in WAT and the brown adipocytes constituting BAT are subjected to different control systems The hypothesis of a different nature of BAT and WAT multilocular ... in genital WAT sections As shown in Fig 1, in the WAT of C57 WT mice maintained at 24 °C, only 1.1% of the total adipocytes was multilocular The effects of the lack of b3-adrenoceptor were striking ... induced the expression of UCP1 in some of them in both WT and b3KO mice Mice maintained singly housed at 24 °C are under a mild cold stimulus It is interesting to note in the WAT of C57 mice at 24...
  • 7
  • 368
  • 0
Báo cáo y học:

Báo cáo y học: "Collagen-induced arthritis in C57BL/6 mice is associated with a robust and sustained T-cell response to type II collagen" pot

Báo cáo khoa học

... as methotrexate Competing interests The authors declare that they have no competing interests uted to the preparation of the manuscript All authors read and approved the final manuscript Acknowledgements ... to that of RA, with a therapeutic action of methotrexate at a dose comparable to human therapy This is in contrast to CIA in DBA/1 mice, in which methotrexate had no effect One of the anti-inflammatory ... therefore, an increasing need to model the anti-arthritic effects of methotrexate in combination with other therapies in order to optimise treatment regimens and to identify possible interactions Likewise,...
  • 8
  • 372
  • 0
Báo cáo y học:

Báo cáo y học: "Response of the mouse lung transcriptome to welding fume: effects of stainless and mild steel fumes on lung gene expression in A/J and C57BL/6J mice" pot

Báo cáo khoa học

... patterns within this strain to these welding fumes; this was in contrast to the A/J strain (see panel A) By 16 weeks post-exposure, 35 annotated genes resulted in distinct subclusters among the ... profiling in these mouse strains complements these findings More specifically, an attenuated downregulation of the transcriptome and a greater number of affected genes in the A/J strain compared to the ... interpretation of our finding that there is a switch from a protective, anti-inflammatory, response to a pro-inflammatory response in the B6 lung is difficult, but particle persistence in the...
  • 18
  • 382
  • 0
báo cáo hóa học:

báo cáo hóa học: " Treatment with gelsolin reduces brain inflammation and apoptotic signaling in mice following thermal injury" potx

Toán học

... significant portion of the experiments presented in the manuscript, and participated in the writing of the manuscript QC participated in the design of the study and the preparation of the animal ... penetrate the BBB directly within the first hours, and it is reasonable to speculate that gelsolin could breach the BBB to perform its effect directly in the brain at later time points Nevertheless, ... http://www.jneuroinflammation.com/content/8/1/118 Treatment with gelsolin decreased burn-induced proinflammatory cytokines in the brain To further validate and explore the above findings, we next investigated the time course of...
  • 18
  • 276
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Mucosal mast cell-derived chondroitin sulphate levels in and worm expulsion from FcRγ-knockout mice following oral challenge with Strongyloides venezuelensis" doc

Báo cáo khoa học

... L3 into a hostile intestinal environment in primed KO and WT mice would most likely result in a patent infection in the former but not in the latter Results of this study largely support our ... concentrations of chondroitin sulphates were obtained from the homogenized gut tissue of KO (which contained more mast cells) than WT is an added support that the intraepithelial mast cells in KO ... respectively The results show that significantly higher concentrations of the chondroitin sulphates occurred in the gut washings of WT than KO mice on these days (p < 0.05) In contrast, significantly...
  • 6
  • 222
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Concurrent response to challenge infection with Cryptosporidium parvum in immunosuppressed C57BL/6N mice" pdf

Báo cáo khoa học

... egnellahc a ot tnatsiser erom si muvrap C htiw detcefni ecim N6/LB75C tluda eht taht etartsnomed stluser eseht ,suhT noitcefnier eht tsniaga noitcetorp etaredom a evah stcartxe muvrap C elohw eht dna ... ecim ehT yad ht52 eht litnu stsycoo dehs ton did puorG syad ht52 ot ht5 eht no ralimis yrev erew dna puorg neewteb seitisnetni gniddehs tsycoO tnemirepxe yad-04 eht noitarud eht tuohguorht stsycoo ... muvrap C eht taht etacidni stluser esehT yad ht01 eht no naht yad ht04 eht no rehgih erew spuorg eseht fo sretit ASILE eht ,eromrehtruF spuorg rehto morf tnereffid ton erew puorg noitaluconi tsycoo...
  • 5
  • 249
  • 1
Báo cáo khoa học:

Báo cáo khoa học: "Anti-obesity activity of diglyceride containing conjugated linoleic acid in C57BL/6J ob/ob mice" potx

Báo cáo khoa học

... group, indicating that their effects were not relevant to the daily feed intake The PPAR-γ, CC/AAT/enhancer binding protein α, and fatty aP2 are transcription factors known to be important in adipocyte ... FFA by test solutions might be associated with the decrease of food intake in this study However, the reducing effects on these serum values were stronger in the DG or DG-CLA group than the CLA ... associated with the significant weight loss in the obese mice in this study The CLA inhibited abdominal fat weights which may be associated with their suppression of adipocyte differentiation and...
  • 7
  • 246
  • 0
Báo cáo y học:

Báo cáo y học: " PCEP enhances IgA mucosal immune responses in mice following different immunization routes with influenza virus antigens" pdf

Báo cáo khoa học

... less antigen and adjuvant than the latter While the intestine has the greatest amount of lymphoid tissues, oral immunization presents significant challenges as the gastrointestinal tract is a ... involved with critical analysis of the intellectual content All authors read and approved the final manuscript Competing interests The authors declare that they have no competing interests Received: ... supernatants in order to determine the ability of PCEP in enhancing cytokine production in T- helper (Th) cells in mice immunized by various routes SC immunization with PCEP+X:31 demonstrated the...
  • 11
  • 443
  • 0
báo cáo hóa học:

báo cáo hóa học: " Astrogliosis is delayed in type 1 interleukin-1 receptor-null mice following a penetrating brain injury" pptx

Hóa học - Dầu khí

... associated with astrocytic functions We analyzed http://www.jneuroinflammation.com/content/3/1/15 the expression of the structural protein GFAP as increases in this protein support the integrity of ... assess the functional state of astrocytes after traumatic brain injury, we analyzed the expression of two glutamate transporters, glutamate aspartate transporter (GLAST) and glutamate transporter-1 ... competing interests 13 Authors' contributions 14 HL participated in the design of the study, conducted the experiments on the primary cultures, performed the statistical analysis and prepared the...
  • 11
  • 402
  • 0
báo cáo hóa học:

báo cáo hóa học: " Insulin-like growth factor-I peptides act centrally to decrease depression-like behavior of mice treated intraperitoneally with lipopolysaccharide" ppt

Toán học

... mediated by the IGF-1R With this in mind we determined whether the naturalistic product of IGF-I cleavage within the brain that acts independent of the IGF-1R [45] can exert additional anti-depressant ... largely under the control of the peripheral inflammatory input to the brain These primary signals subsequently initiate an activation of the innate immune system of the brain which is tempered by ... not occur with naïve mice but these neurotrophins attenuated the behavioral changes induced by i.p LPS These data extend the anti-depressant activity of the IGF system by showing that a proteolytic...
  • 38
  • 340
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Impairment of the CD8+ T cell response in lungs following infection with human respiratory syncytial virus is specific to the anatomical site rather than the virus, antigen, or route of infection" pdf

Hóa học - Dầu khí

... it is not the virus bearing the epitope nor local virus replication that results in the decreased functionality of CD8+ CTL in lungs, but rather the pulmonary site of residence of the cells Therefore, ... 82 to 90) that is the immunodominant http://www.virologyj.com/content/5/1/105 CTL epitope in the H-2Kd background [10] Thus, the same RSV epitope was presented in the context of two distinct viruses ... somewhat lower response (15%) of tetramer+CD8+ cells was detected in the lungs after IN infection with VV-M2 Interestingly, despite the lack of VV-M2 replication in the lungs after ID inoculation,...
  • 8
  • 381
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Regional Distribution and Relative Frequency of Gastrointestinal Endocrine Cells in Large Intestines of C57BL/6 Mice" potx

Báo cáo khoa học

... observed in the remaining portions of the large intestinal tract of this strain of mouse Gastrin-IR cells No gastrin-IR cells were observed throughout the large intestinal tract (Table 2) CCK-8-IR cells ... d) In the rectum, the CGA-IR cells were restricted to the basal portions of the acinar cells of the intestinal glands with a low frequency and they were of the open type (Fig 1e) Serotonin-IR cells ... Korea) and water was supplied ad libitum After anesthetizing with ethyl ether, the large intestinal tract of the mice was divided into portions according to the 22 general classification of the mammalian...
  • 6
  • 339
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "In vitro characterization of cells derived from chordoma cell line U-CH1 following treatment with X-rays, heavy ions and chemotherapeutic drugs" pdf

Báo cáo khoa học

... (TOYOBO, Japan) with the following primers: hTP53AF (5’ccattcttttcctgctccacaggaagccga-3’) and hTP53BR (5’ggctaagctatgatgttccttagattaggt-3’) for exons - 9, hTP53CF (5’-ctgtataggtacttgaagtgcagtttctac ... detected Deduced amino acid sequence is indicated at the top, where the mutation deduces Proline at 72 to Arginine Table Cell cycle distribution and DNA contents of the three cell lines Cell line ... heterozygous mutation C > G, causing an amino acid substitution of proline 72 to arginine (Figure 1) Since the substitution has not been reported to confer any dominant negative effects of the...
  • 9
  • 377
  • 0
Sodium valproate-induced congenital cardiac abnormalities in mice are associated with the inhibition of histone deacetylase ppsx

Sodium valproate-induced congenital cardiac abnormalities in mice are associated with the inhibition of histone deacetylase ppsx

Báo cáo khoa học

... 17:16 http://www.jbiomedsci.com/content/17/1/16 HDAC2, FW: GACATATGAGACTGCAGTTGC; RV: ACCTCCTTCACCTTCATCCTC Nkx2.5, FW: CACCCACGCCTTTCTCAGTC; RV: CCATCCGTCTCGGCTTTGT GATA4, FW: CTGTCATCTCACTATGGGCA; ... [26,27] The expression pattern of Tbx5 in the heart is very interesting It is uniformly expressed throughout the entire cardiac crescent early in the developing heart With the development of the ... a tissue loss in interventricular septum (IVS), as indicated by an arrow, between the right ventricle (RV) and the left ventricle (LV) of the heart, whereas the IVS in the heart of the control...
  • 7
  • 288
  • 0
Báo cáo y học:

Báo cáo y học: "Hand-grip strength is a simple and effective outcome predictor in esophageal cancer following esophagectomy with reconstruction: a prospective study" ppt

Báo cáo khoa học

... requiring elective esophagectomy with reconstruction The results of the hand-grip strength did not indicate any specific physiology defect that other tests fail to detect In contrast, the results of ... oral intake is 15.1 days For patients with tumor in the upper third of the esophagus, out of patients had complication but none died of disease within months For tumor in the middle third, out of ... with reconstruction in the group of transthoracic approach Fifty-seven patients had squamous cell carcinoma and the remaining patients had adenocarcinoma The locations included patients in the...
  • 5
  • 426
  • 0
Báo cáo y học:

Báo cáo y học: " Neuroprotective peptide ADNF-9 in fetal brain of C57BL/6 mice exposed prenatally to alcohol" pptx

Báo cáo khoa học

... minutes in the dark A second aliquot of DTT was then added to the sample, bringing the final concentration of DTT to 10 mM The samples were then incubated at room temperature for 30 minutes to ... Committee of Indiana University Bloomington and are in accordance with the guidelines of the Institutional Animal Care and Use Committee at the National Institutes of Health and the Guide for the ... combined into a master file that contains the list of all proteins and peptides identified in the span of all the processed LC-MS/MS analyses Then, the combined master files, incorporated with their...
  • 12
  • 312
  • 0
Báo cáo y học:

Báo cáo y học: " Improvement of platelet dysfunction in chronic myelogenous leukemia following treatment with imatinib: a case report" pps

Báo cáo khoa học

... continued a single-agent treatment strategy with imatinib in an outpatient setting No further episodes of bleeding occurred during the follow-up of the patient During that time, the patient underwent ... leukocyte counts were reached and the therapeutic regimen was switched to the tyrosine kinase inhibitor imatinib While the initial management efficiently led to a reduction of CML blasts, the patient ... analyzed and interpreted the patient data regarding the hematological disease MvBB analyzed and interpreted the patient data regarding the hematological disease and contributed to the writing and...
  • 4
  • 390
  • 0
Báo cáo y học:

Báo cáo y học: "Macrophage pro-inflammatory cytokine secretion is enhanced following interaction with autologous platelets" pdf

Báo cáo khoa học

... expression of phosphatidylserine (Table 1) Interestingly, the data in Figures and showing phagocytosis of platelets incubated only in RPMI media suggests that only partial platelet activation, in the ... a truly resting state Nonetheless, the interaction involving activated platelets is relevant because platelets are most likely activated at sites of tissue injury and perhaps during removal in ... Because the platelets remained in the co-incubation for the entire experiment (24 hrs), the possibility also exists that the inflammatory consequences of plateletmacrophage interactions occur independently...
  • 9
  • 269
  • 0

Xem thêm

Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25