... differences inthe cellular composition ofthe infiltrations between mice administered Ad5- IL17A at an early or late stage At time of euthanasia, C57BL/6J mice treated with Ad5- IL17A vector at wks of ... leukocyte infiltration inthe exocrine glands is often observed at these ages [32,33] Thus, it is important to examine the role ofIL17Ainthe development of SS prior and post to any pathophysiological ... secreting CD4+ Tcells that persisted at least 19 wks for mice treated at wks of age and 11 wks for mice treated at 16 wks of age These observations indicated that theAd5 vector effect was longer than...
... To that end, it is of interest that analyses ofthe murine IL-9 gene identified a genetic defect at the IL-9 locus in C57BL/6 mice [2] To investigate the association of BAL SP-D levels with the ... http://respiratory-research.com/content/4/1/15 Authors' contributions ENA carried out the surfactant protein analysis and analyzed the data MFB participated inthe design ofthe study and contributed to the ... treatment protected against mortality and inhibited the immunoglobulin, eosinophil and Th2 cytokines associated with this model of fungal infection [35,36] Th2 cytokine levels inthe BAL fluid of...
... that the brown adipocytelike cells present in WAT and the brown adipocytes constituting BAT are subjected to different control systems The hypothesis of a different nature of BAT and WAT multilocular ... in genital WAT sections As shown in Fig 1, inthe WAT of C57 WT mice maintained at 24 °C, only 1.1% ofthe total adipocytes was multilocular The effects ofthe lack of b3-adrenoceptor were striking ... induced the expression of UCP1 in some of them in both WT and b3KO miceMice maintained singly housed at 24 °C are under a mild cold stimulus It is interesting to note inthe WAT of C57 mice at 24...
... as methotrexate Competing interests The authors declare that they have no competing interests uted to the preparation ofthe manuscript All authors read and approved the final manuscript Acknowledgements ... to that of RA, with a therapeutic action of methotrexate at a dose comparable to human therapy This is in contrast to CIA in DBA/1 mice, in which methotrexate had no effect One ofthe anti-inflammatory ... therefore, an increasing need to model the anti-arthritic effects of methotrexate in combination with other therapies in order to optimise treatment regimens and to identify possible interactions Likewise,...
... patterns within this strain to these welding fumes; this was in contrast to the A/J strain (see panel A) By 16 weeks post-exposure, 35 annotated genes resulted in distinct subclusters among the ... profiling in these mouse strains complements these findings More specifically, an attenuated downregulation ofthe transcriptome and a greater number of affected genes inthe A/J strain compared to the ... interpretation of our finding that there is a switch from a protective, anti-inflammatory, response to a pro-inflammatory response inthe B6 lung is difficult, but particle persistence in the...
... significant portion ofthe experiments presented inthe manuscript, and participated inthe writing ofthe manuscript QC participated inthe design ofthe study and the preparation ofthe animal ... penetrate the BBB directly within the first hours, and it is reasonable to speculate that gelsolin could breach the BBB to perform its effect directly inthe brain at later time points Nevertheless, ... http://www.jneuroinflammation.com/content/8/1/118 Treatment with gelsolin decreased burn-induced proinflammatory cytokines inthe brain To further validate and explore the above findings, we next investigated the time course of...
... L3 into a hostile intestinal environment in primed KO and WT mice would most likely result in a patent infection inthe former but not inthe latter Results of this study largely support our ... concentrations of chondroitin sulphates were obtained from the homogenized gut tissue of KO (which contained more mast cells) than WT is an added support that the intraepithelial mast cellsin KO ... respectively The results show that significantly higher concentrations ofthe chondroitin sulphates occurred inthe gut washings of WT than KO mice on these days (p < 0.05) In contrast, significantly...
... group, indicating that their effects were not relevant to the daily feed intake The PPAR-γ, CC/AAT/enhancer binding protein α, and fatty aP2 are transcription factors known to be important in adipocyte ... FFA by test solutions might be associated with the decrease of food intake in this study However, the reducing effects on these serum values were stronger inthe DG or DG-CLA group than the CLA ... associated with the significant weight loss inthe obese micein this study The CLA inhibited abdominal fat weights which may be associated with their suppression of adipocyte differentiation and...
... less antigen and adjuvant than the latter While the intestine has the greatest amount of lymphoid tissues, oral immunization presents significant challenges as the gastrointestinal tract is a ... involved with critical analysis ofthe intellectual content All authors read and approved the final manuscript Competing interests The authors declare that they have no competing interests Received: ... supernatants in order to determine the ability of PCEP in enhancing cytokine production in T- helper (Th) cellsinmice immunized by various routes SC immunization with PCEP+X:31 demonstrated the...
... associated with astrocytic functions We analyzed http://www.jneuroinflammation.com/content/3/1/15 the expression ofthe structural protein GFAP as increases in this protein support the integrity of ... assess the functional state of astrocytes after traumatic brain injury, we analyzed the expression of two glutamate transporters, glutamate aspartate transporter (GLAST) and glutamate transporter-1 ... competing interests 13 Authors' contributions 14 HL participated inthe design ofthe study, conducted the experiments on the primary cultures, performed the statistical analysis and prepared the...
... mediated by the IGF-1R With this in mind we determined whether the naturalistic product of IGF-I cleavage within the brain that acts independent ofthe IGF-1R [45] can exert additional anti-depressant ... largely under the control ofthe peripheral inflammatory input to the brain These primary signals subsequently initiate an activation ofthe innate immune system ofthe brain which is tempered by ... not occur with naïve mice but these neurotrophins attenuated the behavioral changes induced by i.p LPS These data extend the anti-depressant activity ofthe IGF system by showing that a proteolytic...
... it is not the virus bearing the epitope nor local virus replication that results inthe decreased functionality of CD8+ CTL in lungs, but rather the pulmonary site of residence ofthecells Therefore, ... 82 to 90) that is the immunodominant http://www.virologyj.com/content/5/1/105 CTL epitope inthe H-2Kd background [10] Thus, the same RSV epitope was presented inthe context of two distinct viruses ... somewhat lower response (15%) of tetramer+CD8+ cells was detected inthe lungs after IN infection with VV-M2 Interestingly, despite the lack of VV-M2 replication inthe lungs after ID inoculation,...
... observed inthe remaining portions ofthe large intestinal tract of this strain of mouse Gastrin-IR cells No gastrin-IR cells were observed throughout the large intestinal tract (Table 2) CCK-8-IR cells ... d) Inthe rectum, the CGA-IR cells were restricted to the basal portions ofthe acinar cellsofthe intestinal glands with a low frequency and they were ofthe open type (Fig 1e) Serotonin-IR cells ... Korea) and water was supplied ad libitum After anesthetizing with ethyl ether, the large intestinal tract ofthemice was divided into portions according to the 22 general classification ofthe mammalian...
... (TOYOBO, Japan) with the following primers: hTP53AF (5’ccattcttttcctgctccacaggaagccga-3’) and hTP53BR (5’ggctaagctatgatgttccttagattaggt-3’) for exons - 9, hTP53CF (5’-ctgtataggtacttgaagtgcagtttctac ... detected Deduced amino acid sequence is indicated at the top, where the mutation deduces Proline at 72 to Arginine Table Cell cycle distribution and DNA contents ofthe three cell lines Cell line ... heterozygous mutation C > G, causing an amino acid substitution of proline 72 to arginine (Figure 1) Since the substitution has not been reported to confer any dominant negative effects of the...
... 17:16 http://www.jbiomedsci.com/content/17/1/16 HDAC2, FW: GACATATGAGACTGCAGTTGC; RV: ACCTCCTTCACCTTCATCCTC Nkx2.5, FW: CACCCACGCCTTTCTCAGTC; RV: CCATCCGTCTCGGCTTTGT GATA4, FW: CTGTCATCTCACTATGGGCA; ... [26,27] The expression pattern of Tbx5 inthe heart is very interesting It is uniformly expressed throughout the entire cardiac crescent early inthe developing heart With the development ofthe ... a tissue loss in interventricular septum (IVS), as indicated by an arrow, between the right ventricle (RV) and the left ventricle (LV) ofthe heart, whereas the IVS inthe heart ofthe control...
... requiring elective esophagectomy with reconstruction The results ofthe hand-grip strength did not indicate any specific physiology defect that other tests fail to detect In contrast, the results of ... oral intake is 15.1 days For patients with tumor inthe upper third ofthe esophagus, out of patients had complication but none died of disease within months For tumor inthe middle third, out of ... with reconstruction inthe group of transthoracic approach Fifty-seven patients had squamous cell carcinoma and the remaining patients had adenocarcinoma The locations included patients in the...
... minutes inthe dark A second aliquot of DTT was then added to the sample, bringing the final concentration of DTT to 10 mM The samples were then incubated at room temperature for 30 minutes to ... Committee of Indiana University Bloomington and are in accordance with the guidelines ofthe Institutional Animal Care and Use Committee at the National Institutes of Health and the Guide for the ... combined into a master file that contains the list of all proteins and peptides identified inthe span of all the processed LC-MS/MS analyses Then, the combined master files, incorporated with their...
... continued a single-agent treatment strategy with imatinib in an outpatient setting No further episodes of bleeding occurred during the follow-up ofthe patient During that time, the patient underwent ... leukocyte counts were reached and the therapeutic regimen was switched to the tyrosine kinase inhibitor imatinib While the initial management efficiently led to a reduction of CML blasts, the patient ... analyzed and interpreted the patient data regarding the hematological disease MvBB analyzed and interpreted the patient data regarding the hematological disease and contributed to the writing and...
... expression of phosphatidylserine (Table 1) Interestingly, the data in Figures and showing phagocytosis of platelets incubated only in RPMI media suggests that only partial platelet activation, inthe ... a truly resting state Nonetheless, the interaction involving activated platelets is relevant because platelets are most likely activated at sites of tissue injury and perhaps during removal in ... Because the platelets remained inthe co-incubation for the entire experiment (24 hrs), the possibility also exists that the inflammatory consequences of plateletmacrophage interactions occur independently...