calculation of the specific surface area from isotherms of type i without a multilayer plateau and measured below the critical temperature

báo cáo khoa học: "Determination of the volume-specific surface area by using transmission electron tomography for characterization and definition of nanomaterials" docx

Ngày tải lên : 11/08/2014, 00:23

... projection requirement is met [4]; (ii) missing wedge artifacts are minimal and (iii) isosurface rendering optimally fits the NM surface Our results indicate that, in principle, the characterization ... characterization and definition of NM can benefit from application of conventional BF ET In the scope of putting this technique in practice for the characterization and definition of gold and silica NM, ... hardly sensitive to radiation damage, extensive data collection using a high frequency of imaging can be applied Because our software and hardware limit the amount of data that can be aligned and reconstructed...

8
373
0

High specific surface area porous sic ceramics coated with reticulated amorphous sic nanowires

Ngày tải lên : 16/03/2014, 15:17

... process for the fabrication of high speciﬁc surface area porous SiC ceramics, which are coated completely with reticulated amorphous SiC nanowires Commercially available phenolic resin and silicon powders ... This is in accordance with the XRD analysis mentioned above Table lists the data for the obtained high speciﬁc surface area porous SiC ceramics coated completely by reticulated SiC nanowires measured ... and Design Institute, Beijing, China) and silicon powder (average particle size of 9.4 mm; Beijing Da Di Zelin-Silicon Limited Company, Beijing, China) were used as carbon source and silicon source,...

5
297
1

Tài liệu Báo cáo khoa học: The localization of FGFR3 mutations causing thanatophoric dysplasia type I differentially affects phosphorylation, processing and ubiquitylation of the receptor pptx

Ngày tải lên : 19/02/2014, 00:20

... wild -type and the K650M mutant receptor was analysed as in (B) A faint biotinylated band is visible with the K650M mutant after and h signiﬁcant amounts of biotinylated receptor after h Similar ... back to the plasma membrane The E3-ubiquitin ligase c-Cbl is directly involved in the ubiquitylation of several RTKs [24–26,32] and may participate in the downregulation of FGFR1 via an indirect ... that propagate FGFR signals via different signalling pathways resulting in the regulation of many cellular processes including proliferation, differentiation, migration and survival [1–4] Dominant...

16
573
0

Báo cáo khoa học: Promoters of type I interferon genes from Atlantic salmon contain two main regulatory regions docx

Ngày tải lên : 07/03/2014, 12:20

... G A A G G A A G G G A G A A A A A A A A A A A A A A A A A A C G T G T G T T G C G C G G G A G A A G A A A A A A A A A A A A A A A A G A G A T C G T T A T A X00973 AL353732 AL353732 AL353732 X02955 ... attgctagcgttcacgcgaagttattatcagttg agctagcaaggagaatgtgtatagatttactgtga attgctagctgctgcatgtgctagtctggaaaatg attaagcttgacattaatttagtgggtttcgttca tgcagtatgcagagcgtgtg tctcctcccatctggtccag ttcgtccaggagaaggagca ctgatcaacctaccggaggc ... actttataaactggtaagggcgtagc cgtttttattcacattttcaatgttattttttcat attaagcttgctgtttgtttcgctgttagttttc attgctagcaaccaaggcctgtatttattaagca attgctagcagccctgtcaaaactattgactctg attgctagcgttcacgcgaagttattatcagttg...

14
379
0

báo cáo hóa học:" Whole blood assessment of antigen specific cellular immune response by real time quantitative PCR: a versatile monitoring and discovery tool" potx

Ngày tải lên : 18/06/2014, 15:20

... antigens or peptides and the rapid identification of novel antigenic epitopes Classical methods allowing the physical identification and the sorting of cells endowed with peculiar functional profiles ... multimer staining of antigen specific T cells, intracellular staining with cytokine specific antibodies, ELISPOT or ELISA assays for antigen driven cytokine production, antigen specific cytotoxicity ... laboratory facilities Indeed, although the subsequent analysis of cytokine gene expression requires adequate infrastructure, initial antigen stimulation and safe storage and transportation of...

9
438
0

báo cáo sinh học:" Effectiveness of a training-of-trainers model in a HIV counseling and testing program in the Caribbean Region" pot

Ngày tải lên : 18/06/2014, 17:20

... trained in clinical skills, clinical training skills and advanced training skills, as well as the number of trainings each clinical trainer and advanced trainer had conducted since the training http://www.human-resources-health.com/content/7/1/11 ... participated in the analysis of the trainer data, as well as contributed to the literature review and writing the article RMcL conducted the analysis of the TIMS data for the external evaluation ... St Kitts & Nevis, St Lucia, St Vincent & the Grenadines, and Surinam in 2003; to Barbados and the Bahamas in 2004; and to Anguilla, Antigua & Barbuda, Dominica, Grenada, and Turks & Caicos in...

8
450
0

Function of Soils for Hum a n Societies and the Environment .The G e o l o g i c a l Society of L ppt

Ngày tải lên : 06/07/2014, 08:20

... Society's international journals and books, and acts as European distributor for selected publications of the American Association of Petroleum Geologists (AAPG), the Indonesian Petroleum Association ... Salem, MA 01970, USA: the item-fee code for this publication is 0305-8719/06/$15.00 British Library Cataloguing in Publication Data A catalogue record for this book is available from the British ... pedogenetic processes, and implications for ecological risk assessment 63 BA~UELOS, G S & LIN, Z.-O Reuse of agricultural drainage water in central California: phytosustainability in soil with high...

5
287
0

Báo cáo y học: "An interesting journey of an ingested needle: a case report and review of the literature on extraabdominal migration of ingested Foreign bodies" pdf

Ngày tải lên : 10/08/2014, 09:21

... reviewing the literature on extra-abdominal migration of swallowing foreign bodies, Macchi at al reported a case of a 48-year-old man with esophageal perforation, mediastinitis, and evidence of ... require emergent surgical intervention Ventilation, airway compromise and the risk of aspiration should also be assessed If the swallowed object is radio-opaque, a single frontal radiograph that ... perforation of the ascending aorta during surgical drainage of the mediastinum They reported finding a fish bone under the aortic arch at autopsy [5] Kunishige et al presented a 79-year-old woman...

4
407
0

Báo cáo y học: " Intricacies in the surgical management of appendiceal mucinous cystadenoma: a case report and review of the literature" ppt

Ngày tải lên : 11/08/2014, 12:20

... extensive areas of fibrosis and patchy acute and chronic non -specific inflammation were also seen in the wall of the appendix No significant cytological atypia or invasion of the appendiceal wall ... this distinction remains elusive and cannot be established with any degree of reliability if we are to depend solely on physical examination findings and radiological imagings Histopathological ... findings in patients with mucinous cystadenomas include cystic masses with low attenuation, irregular wall thickening and absence of associated appendiceal inflammation [1,7] Mural calcification...

4
427
0

Báo cáo y học: "Bezoar in gastro-jejunostomy presenting with symptoms of gastric outlet obstruction: a case report and review of the literature" pdf

Ngày tải lên : 11/08/2014, 21:22

... chest radiograph showed an air-fluid level within a dilated stomach (Figure 2a) In view of the examination and chest radiograph findings, she had a nasogastric tube and urinary catheter inserted ... obstruction and its associated complications, other complications of bezoars include ulceration, intussusception, and bowel perforation Intraluminal bezoar is a serious condition, with a mortality rate ... condition but can potentially cause significant morbidity and mortality Consent Written informed consent was obtained from the patient for publication of this case report and any accompanying images...

5
368
0

báo cáo khoa học:" Traumatic bone cyst of the mandible of possible iatrogenic origin: a case report and brief review of the literature" ppsx

Ngày tải lên : 11/08/2014, 23:22

... Occasional macrophages were present (haematoxylin-eosin × 160) ative radiographic examination was negative at that time and no cystic lesion was found in the area during the surgical extraction of ... of the patients had a definite history of trauma and the author noted that the severity of the trauma was a striking feature in most of the cases and that this finding suggests that trauma may ... in order to reach the lesion The The following is an account of a well documented radiographically and histopathologically atypical case of TBC involving the ramus of the mandible, which is also...

5
363
0

Tài liệu Báo cáo khoa học: Identi®cation and properties of type I-signal peptidases of Bacillus amyloliquefaciens doc

Ngày tải lên : 21/02/2014, 03:20

... GGCGATGTCATCACTTTTACACAA AACACACAGAATAATCGGGATCAC GAGAATTCAAAAGAAAGCGGGGAAGAA CGAGATCTTGTGGACATGGTCCCGTTTC CGGAATTCGCTAATGGGAGGAAATCAC TACAGATCTTTTCGTCTTGCGAATTTC CAGAATTCGTCTAGGAGGAACCACGTT GCGAGATCTTTTTGTCTGACGCATATC ... GCGAGATCTTTTTGTCTGACGCATATC CAGCAATTGACCCTTAGGAGTTGGCAT GATGGATCTATGGATGCCGCCAATG GCAAAGCTTATTTTGGATGATAACGAGGCG GCGAATTCCTACCAGACGAGAACTTAAGCC GTTTTCCCATGCACGAC GTAAAACGACGGCCAGT Cloning of sipU Cloning of sipU ... TTGAAYGCNAARACNATHACNYTNAARAA TTGAARAARMGNTTYTGGTTYYTNGC GTNTTYATNGTYTAYAARGTNGARGG TCNGCRTCNSWNATNACNCCNACNAT GCCAAAACAACGATAAGCACGCC GGATTCATGCTGATTCCTTCGAC ACTTGGCACTACACCGCACCTCATGCG ATTTCGTGATTGGCGACAACCGC...

12
595
0

Báo cáo khoa học: "From Single to Multi-document Summarization: A Prototype System and its Evaluation" pptx

Ngày tải lên : 17/03/2014, 08:20

... encouraged to investigate alternative approaches in summarization and report their results NeATS participated only in the fully automatic multi-document summarization task A total of 12 systems participated ... Croatia, Yugoslavia, Slovenia, republic, and are joined due to the connections as follows: • Slovenia Croatia • Croatia Slovenia • Yugoslavia Slovenia • republic Slovenia Closed class words (of, ... 53% This suggests assessors did write something similar in their summaries but not exactly the same; once again illustrating the difficulty of summarization evaluation (4) Despite the low inter...

8
288
0

Báo cáo khoa học: A comparative study of type I and type II tryparedoxin peroxidases in Leishmania major pot

Ngày tải lên : 23/03/2014, 07:20

... Cys83Ala R-TDPX1 Cys83Ala TATATCATATGTCTATCTACGACTTCAAGGTC ATATAGGATCCTCACGATTGAGTGCTTGG ATATATCATATGTCCGGTGTCGCAAAG ATATAGGATCCTTACTCGTCTCTCCACGG ATATATCATATGTCCTGCGGTAACGCC ATATAGGATCCTTACTGCTTGCTGAAGTATC ... Despite the fact that Leishmania 5644 spp are obligate intracellular parasites of macrophages, and therefore live in a potentially hostile oxidizing environment in the mammalian stage of their life ... wild -type activity with TryX indicating that formation of an intramolecular disulde is important for interaction with TryX In contrast, this mutant displayed signicant activity with dithiothreitol...

16
483
0

Báo cáo khoa học: Signalling and regulation of collagen I synthesis by ET-1 and TGF-b1 doc

Ngày tải lên : 23/03/2014, 11:20

... regulating the induction of collagen I synthesis by CTGF Further examination of the intracellular signalling mechanisms revealed an essential involvement of Gai, PLD and PC-PLC Their inhibition abolished ... human primary dermal ﬁbroblasts Statistical analysis Statistical analysis was performed using GraphPad Prism version 3.02 All data were expressed as means ± SEM and statistically analysed using ... Palmitoylation of endothelin receptor A Differential modulation of signal transduction activity by translational modiﬁcation J Biol Chem 271, 20811–20819 25 Takigawa M, Sakurai T, Kasuya Y, Abe...

13
548
0

Báo cáo khoa học: Disorder–order transition of k CII promoted by low concentrations of guanidine hydrochloride suggests a stable core and a ﬂexible C-terminus doc

Ngày tải lên : 30/03/2014, 20:20

... regions in the protein serve as the initial attacking point for proteases and thereby play a key regulatory role The protease that plays a crucial role in the degradation of CII in vivo is HﬂB The ... tertiary interactions of the aromatic residues, while there was a signiﬁcant gain of secondary structure There are three tryptophan and two phenylalanine residues in the CII protein and tyrosine ... conformation of the protein, thus shifting the equilibrium More detailed investigations on the interaction of the guanidium ion with this protein are needed to understand the physico-chemical basis...

8
422
0

Báo cáo hóa học: " Wild type measles virus attenuation independent of type I IFN" pdf

Ngày tải lên : 20/06/2014, 01:20

... measles Laboratory Animal Science 1996, 46(3):315-320 Takeda M, Kato A, Kobune F, Sakata H, Li Y, Shioda T, Sakai Y, Asakawa M, Nagai Y: Measles virus attenuation associated with transcriptional impediment ... the complexity and the diversity of the experimental systems previously used made a clear-cut interpretation of these data difficult in the estimation of the role of type I IFN in the attenuated ... (Biogentex, Ozyme, France) and treated with DNase I (Sigma) Detection and quantification of MV -specific RNA Detection of efficient replication in mice brains (presence of mRNA coding for N), was...

12
271
0

Báo cáo toán học: " On Systems of Quasivariational Inclusion Problems of Type I and Related Problems" potx

Ngày tải lên : 06/08/2014, 05:20

... Guerraggio and Tan [4] etc for quasi-equilibrium problems and quasivariational inequalities; Blum and Oettli [5], Tan [7], Minh and Tan [8], Ky Fan [9] etc for equilibrium and variational inequality ... conditions, is also a solution of some other systems of quasi-optimization problems, quasi-equilibrium problems, quasivariational problems etc Preliminaries and Deﬁnitions Throughout this paper, as in the ... Fan, A minimax inequality and application, in Inequalities III, O Shisha (Ed.), Academic Press, New-York, 1972, p 33 10 D T Luc, Theory of Vector Optimization, Lecture Notes in Economics and Mathematical...

18
292
0

Báo cáo lâm nghiệp: "Infra-red images of heat field around a linear heater and sap flow in stems of lime trees under natural and experimental conditions" doc

Ngày tải lên : 08/08/2014, 01:22

... remained on the same place at the heater axis on the frontal image Similarly the disappearing warm zone remained symmetrical along the axis of the heater at the radial images of the smoothed ... scheme and lower left IRimage) Ratio of heat conductivities, R, in axial and tangential directions in stems is always higher than 1 .The stem xylem is a complex material consisting mainly of cell-wall ... Visualization of the heat field also allows evaluation of optimal positioning of the sap flow sensors For this purpose the mathematical properties of the dynamics of heat field (via ellipses with...

11
287
0

báo cáo khoa học: "A cytogenetic survey was carried out on fattening male and female pigs of different lines in a local herd and on " ppsx

Ngày tải lên : 09/08/2014, 22:22

... 66 female and male animals of different lines raised on a fattening farm of the southern region of GDR, and from 461 A .I boars of a breeding station Each sample (2.0 ml) was incubated at 37 °C ... in A .I boars of the Landrace Among 62 Landrace animals analysed, boars showed a heterozygote 13/17 Robertsonian translocation In the other breeds investigated, this translocation was absent In ... translocation carriers among the A .I boars of the Landrace indicates that possible effects on performance not effect an elimination of the translocation from breeding animals All the carriers in this study...

7
313
0