calculate the specific gravity of a natural gas with the following composition

Combustion and emission characteristics of a natural gas fueled diesel engine with EGR

Ngày tải lên : 15/06/2014, 09:26

... mode Appendix A The value of the speciﬁc heat ratio (c) used to calculate the net heat release rate (HRR) varies with the variation of the gas temperature inside the cylinder, and it can be calculated ... contains a variety of air–fuel ratios Therefore, the ﬂame is well-anchored depending on the value of the local AFR; irrespective of the value of the overall AFR, which can reach a value of 100 ... (dilution effect natural gas causes a larger of EGR), and to the increase in the mixture heat capacity (thermal take place closer to the TDC; i.e at the beginning of the power effect of EGR) With higher...

12
573
0

Báo cáo y học: "Distinctive receptor binding properties of the surface glycoprotein of a natural Feline Leukemia Virus isolate with unusual disease spectrum" pps

Ngày tải lên : 13/08/2014, 01:20

... each case is underlined: 1) the mutant designated 61E/945-5 using primer 5’ACTAGTGTTGGATCCTAACAACGTTCGGCATGGAGCTAGGTATAGCAGTAGCAAATATGGATGTAAAACTACAGATAG-3’, 2) the mutant designated VRB3aa using ... 5’-GAGGGAGTAATCAGGACAATAGCTGCACAGGAAAATGCAACCCCC-3’, 3) the mutant designated N147S using primer 5’-GGGAGTAGTCAGGACAATAGCTGTGAGGG-3’, 4) the mutant designated K128N/S130T using primer 5’GCAACCCCCTAGTCTTACAGTTCACCCAGAAGGGAAGACAAGCCTCTTGG-3’, ... 5’GCAACCCCCTAGTCTTACAGTTCACCCAGAAGGGAAGACAAGCCTCTTGG-3’, 5) the mutant designated I156V/K164R using primer 5’-GGAGAAGCTTGGTGGAATCCCACCTCCTCATGG-3’, and 6) the mutant designated I186V using primer 5’GGATATGACCCTGTCGCTTTATTCACGGTGTCCCGGCAGG-3’...

17
267
0

Tài liệu Báo cáo khoa học: Specific targeting of a DNA-alkylating reagent to mitochondria Synthesis and characterization of [4-((11aS)-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-on-8-oxy)butyl]-triphenylphosphonium iodide doc

Ngày tải lên : 20/02/2014, 11:20

... mtDNA in mitochondria or cells The reasons for the lack of alkylation of mtDNA within mitochondria by mitoDC-81 are unclear The local concentrations of mitoDC-81 and DNA, and the duration of the ... considerable alkylation of the DNA ladder by mitoDC-81 (Fig 3B, lane 1) Analysis of the gel prior to electrotransfer showed that the extent of alkylation was proportional to the amount of DNA present ... both approaches appeared to lead to the accumulation of a PNA within the mitochondria of cultured cells, neither affected the proportion of mutated mtDNA in heteroplasmic myoclonic epilepsy with...

10
638
0

Đề tài " The number of extensions of a number field with fixed degree and bounded discriminant " docx

Ngày tải lên : 06/03/2014, 08:21

... elementary arguments from the geometry of numbers and linear algebra Acknowledgments The authors are grateful for the hospitality of the American Institute of Mathematics, where the first phase of ... is a lattice endowed with a natural quadratic form, namely x → tr(x2 ); as such, it defines an element [L] of the moduli space S of homothety classes of positive definite quadratic forms S can ... tools, the central idea will always be to count fields by counting integral points on certain associated varieties, which are related to the invariant theory of the Galois group These varieties...

20
478
0

Báo cáo khoa học: Structure of the complex of a yeast glucoamylase with acarbose reveals the presence of a raw starch binding site on the catalytic domain doc

Ngày tải lên : 07/03/2014, 12:20

... GLU R1 5A forward (5¢-ATTCAAACTATAAAGTTGACGCAA CTGACTTGGAAACCTTC-3¢), GLU R1 5A reverse (5¢GAAGGTTTCCAAGTCAGTTGCGTCAACTTTATAGTT TGAAT-3¢); GLU H44 7A forward (5¢- GCAAGTCATTT TGGATGCTATTAATGATGATGGCTC-3¢), ... H44 7A reverse (5¢- GAGCCATCATCATTAATAGCATCCAAAA TGACTTGC-3¢); GLU T46 2A forward (5¢- GAACAACTT AACAGATATGCCGGTTATTCCACCGGTGCC-3¢), GLU T46 2A reverse (5¢- GGCACCGGTGGAATAACCGGCA TATCTGTTAAGTTGTTC-3¢); ... toroid, and is closely similar to that of the catalytic domain of A awamori and T thermosaccharolyticum glucoamylases, with the active site at the narrower end of barrel There is no terminal starch-binding...

11
548
0

báo cáo hóa học:" Meaning in life in the Federal Republic of Germany: results of a representative survey with the Schedule for Meaning in Life Evaluation (SMiLE)" ppt

Ngày tải lên : 20/06/2014, 16:20

... individual MiL in a representative sample of the German population to gather data for future comparisons with cancer and palliative care patients More specifically, the study aimed (i) to evaluate and ... CI Figure and gender on IoS Results of the multifactorial analysis with the effects of age Results of the multifactorial analysis with the effects of age and gender on IoS Page of (page number ... significantly higher levels of family life satisfaction and community satisfaction [35] Inhabitants of the affluent German South-West (BadenWuerttemberg, Bavaria, Hesse/Rhineland-Palatinate/Saarland,...

8
382
0

báo cáo hóa học: " Glrt-Based Array Receivers for The Detection of a Known Signal with Unknown Parameters Corrupted by " docx

Ngày tải lên : 21/06/2014, 00:20

... which generate estimates of the noise covariance matrix with more variance when primary data are used More precisely, the variance of the noise covariance matrix estimate and then the associated performance ... (called primary observation vectors) For example the secondary observation vectors may correspond to samples of data associated with another range than the range of the detected target in radar ... R(nT), C(nT), s TNAR available R, C on sec data TNAR available R, C on sec + prim data No TNAR No TNAR available R, C on sec data TNAR available R, C on sec + prim data No TNAR - 29 - Receivers...

45
467
0

ON WEAK SOLUTIONS OF THE EQUATIONS OF MOTION OF A VISCOELASTIC MEDIUM WITH VARIABLE BOUNDARY V. G. pptx

Ngày tải lên : 23/06/2014, 00:20

... approximation of the equation in a weak sense and application of the topological theory of a degree that allows to establish the existence of solutions on the basis of a priori estimates and statements ... statements about passage to the limit Note that in the case of a not cylindrical domain (with respect to t) the necessary spaces of diﬀerentiable functions cannot be regarded as spaces of functions of ... prove a similar result for a domain with changing boundary The article is organized as follows We need a number of auxiliary results about functional spaces for the formulation of the basic results...

31
266
0

Báo cáo lâm nghiệp: "Conversion of a natural broad-leafed evergreen forest into pure plantation forests in a subtropical area: Effects on carbon storage" pps

Ngày tải lên : 08/08/2014, 00:22

... CK, Castanopsis kawakamii plantation forest; NF, natural forest of C kawakamii The abbreviations are the same as elsewhere Castanopsis kawakamii is only involved Six soils were randomly taken ... (85% of total stand basal area for C kawakamii), old age (~ 150 year), and large area (~ 700 ha) In addition to C kawakamii, the overstorey also contained other tree species, such as Pinus massoniana, ... such as Cunninghamia lanceolata (Chinese fir, CF), Fokienia hodginsii (FH), Ormosia xylocarpa (OX) and Castanopsis kawakamii (CK) that grown on a same soil and with the same former forest, natural...

10
384
0

Báo cáo toán học: "A Decomposition Algorithm for the Oriented Adjacency Graph of the Triangulations of a Bordered Surface with Marked Point" potx

Ngày tải lên : 08/08/2014, 14:23

... in determining the mutation class of a quiver In [2], the authors prove that the mutation class of an adjacency matrix associated to a triangulation of a bordered surface with marked points is ... signed adjacency matrix B = B(T ) that reﬂects the combinatorics of T The rows and columns of B(T ) are naturally labeled by the arcs in T For notational convenience, we arbitrarily label these arcs ... uniquely associated to a triangulation of a piece of surface Gluing elementary blocks corresponds to a gluing of associated triangulated pieces of surfaces along arcs of triangulations (see [2]) Therefore,...

45
262
0

Báo cáo y học: "Identification of a SmD3 epitope with a single symmetrical dimethylation of an arginine residue as a specific target of a subpopulation of anti-Sm antibodies" ppsx

Ngày tải lên : 09/08/2014, 06:22

... peptide-based assay (99.8%; data not shown) Further studies are in progress to compare the assay performance of the anti-SMP assay with that of other commercially available anti-Sm immunoassays For ... containing dimethylated arginine residues for epitopes assay Assay performance characteristics of the anti-SmD3 peptide (SMP) assay (a) Intra-assay and interassay variability, (b) linearity, and ... based on the general protocol of the Varelisa® tests (Pharmacia Diagnostics) Assay performance characteristics To evaluate the performance of the assay, the precision, reproducibility and linearity...

11
593
0

báo cáo khoa học: "The cadaver of a Caucasian man with a supernumerary fourth dorsal interosseous muscle in the right hand: a case report" ppt

Ngày tải lên : 10/08/2014, 23:20

... publication of this case report and any accompanying images A copy of the written consent is available for review by the Editor-in-Chief of this journal Author details Department of Anatomy, Medical ... hands Also, after a metacarpal fracture, the bony fragments often are dislocated because of traction from the surrounding muscles [6] One of the most common fractures is of the head of the fifth ... et al.: The cadaver of a Caucasian man with a supernumerary fourth dorsal interosseous muscle in the right hand: a case report Journal of Medical Case Reports 2011 5:393 Submit your next manuscript...

2
221
0

Báo cáo y học: " Pelvo-ureteric junction obstruction in the lower pole moiety of a duplex kidney with an associated intraparenchymal abscess: a case report" pot

Ngày tải lên : 11/08/2014, 21:22

... the differential diagnosis was either a tumour or an abscess Given that the patient was septic, this cystic lesion with an enhancing capsule was likely to be an abscess rather than a tumour Again ... collection and clear urine via Figure fat saturation and gadolinium enhancement T1-weighted coronal magnetic resonance imaging scan with T1-weighted coronal magnetic resonance imaging scan with fat saturation ... All authors have read and approved the final manuscript Consent Written informed consent was obtained from the patient for publication of this case report and any accompanying images A copy of...

3
306
0

báo cáo khoa học:" General and disease-specific quality of life in patients with chronic suppurative otitis media a prospective study" pot

Ngày tải lên : 12/08/2014, 01:22

... (TM3) Tympanoplasty was performed in all patients In most of the cases a retroauricular incision with a tympanomeatal flap was made In cholesteatoma cases canal wall up and canal wall down procedures ... titaniummade total and partial ossicular replacement prostheses (TORP and PORP) In the latter cases a cartilage sheet of a size just a bit larger than the prosthesis head to overlap it was prepared ... Ninety patients (44 males and 46 females, response rate 74.4%) with a median age of 52 years (range 18 to 75 years) participated in all questionings and examinations The data of these patients...

6
241
0

Báo cáo y học: "Whole genome sequencing of a natural recombinant Toxoplasma gondii strain reveals chromosome sorting and local allelic variants" ppsx

Ngày tải lên : 14/08/2014, 21:20

... estimate of the age of the MRCA of all strains was calculated based on major and minor SNPs in intronic regions using the results obtained by application of the intron mutation rate These estimates ... quality of information generated and availability of the putative parental strains to this natural recombinant provide an excellent basis for a better understanding of the gene combinations responsible ... in the case of additional targeted sequencing of all Ugandan isolates, comparisons were made with all type I, II and III reference strains The distribution of SNPs in TgCkUg was also mapped against...

17
324
0

A site specific design of a fixed pitch fixed speed wind turbine blade with multiple airfoils as design variable

Ngày tải lên : 09/09/2015, 10:17

... represents the speed of the wind and k and c are the shape and scale parameters of the distribution After a calculation of the Coefficient of Power (Cp) curve by BEM theory, the AEP can be obtained with ... S809 The plot indicates that the designed airfoils have a maximum aerodynamic efficiency lower than that of the S809’s, however they have larger values for a larger range of the angles of attack ... that the angles of attack in the airfoils go from around degrees to around 22 This indicates that instead of a maximization of the Cl /Cd of the airfoil for a given alphadesign, the optimization...

12
347
0

Discovery of botanical flavonoids as dual peroxisome proliforator, activated receptor (PPAR) ligands and functional characterization of a natural PPAR polymorphism that enhances interaction with nuclear compressor

Ngày tải lên : 12/09/2015, 08:20

... Characterization of flavonoids on PPARα and PPARγ activity 103 3.3 Characterization of flavonoids and PPARα ligands on a natural PPARα V22 7A variant 124 3.4 Mechanism(s) elucidation of attenuated ... 2004 at Shanghai International Convention Center, Shanghai, China xiv ABBREVIATIONS 15dPGJ2 Å3 ABCA1 ACO Acrp30 AD AF-1 AF-2 AM aP2 apoA-I apoA-II apoA-V apoC-III AR bp Bio Cal CAP350 CARM-1 ... regulation can be affected by the action of AF-1 and AF-2, the dimerization of RXR on the PPRE, the regulation of PPAR expression, the post-translational modifications of PPAR; and the association with...

263
267
0

Modeling and optimization of liquefied natural gas process

Ngày tải lên : 14/09/2015, 08:45

... the years Although natural gas (NG) is the natural choice among fossil fuels, most NG reserves are offshore and away from demand sites Liquefied natural gas (LNG) is the most economical means ... only factor that affects the performance of a GO algorithm The quality of relaxation from a larger model may be better than that from a smaller model The use of the larger model in a GO algorithm ... example, during summer, when the ambient temperature is high and the gas turbines are operating at maximum available power, the plant operators change several parameters such as refrigerant composition, ...

215
556
0

Tài liệu Báo cáo khóa học: New activities of a catalytic antibody with a peroxidase activity ppt

Ngày tải lên : 19/02/2014, 12:20

... of a ligand, such as nitrosoalcane, to the iron of MP8, it brings a partial steric hindrance on the distal face of MP8 and thus controls access of the nitrosoalcane ligand to the iron atom of ... complex into a hydrophobic pocket with no change of the Fe(II) spin state and no replacement of any of the two axial ligands of the iron, His18 or RNO, by an amino acid side-chain of the antibody ... complexes, with aborption maxima at approximately 413 and 530 nm (Table 1) [20] The reactivity of these new complexes was very similar to that of the MP8–Fe(II)–RNO complexes and that of other already...

7
447
0

Báo cáo khoa học: Reduction of a biochemical model with preservation of its basic dynamic properties doc

Ngày tải lên : 07/03/2014, 11:20

... + NAD+ fi BPG + NADH BPG + ADP fi ACA + ATP ACA + NADH fi NAD+ ATP fi ADP Glc + ATP fi ADP trioseP + NADH fi NAD+ ACA Ð ACA x ACAx fi GAPDH: lowpart: ADH: ATPase: storage: glycerol: difACA: outACA: ... indicated in Table All the underlying parameter values are the same as in the 20D model, i.e no parameter optimization was done in the elimination of variables approach The model’s parameters are ... the bars indicate the importance of the feedback loops associated with each of the species, as determined by interaction analysis es is the smallest scalar perturbation of the linear feedback of...

16
492
0