c his mother works in a

Tài liệu ELECTRICAL /DATA CABLING WORKS IN THE BRANCH OF BANK OF INDIA, BHULLAR , LUDHIANA. doc

Tài liệu ELECTRICAL /DATA CABLING WORKS IN THE BRANCH OF BANK OF INDIA, BHULLAR , LUDHIANA. doc

Ngày tải lên : 16/02/2014, 11:20
... RM’S Cabin adjacent Branch Manager’s Cabin The modules having indicative sizes of the Diamond Customer Lounge along with Relationship Manager’s Cabin and Branch Manager’s Cabin and Diamond Customer ... Print set available 500/- per set) And Bank of India Zonal Manager Regional Office, Ludhiana 47 Any clarification regarding drawing Please Contact: ARCHITECTS : M/S HERZI SINGH & ASSOCIATES Plot ... be as per relevant Indian Standard Specification Where it is mandatory to use I S Marked materials, the contractor shall arrange the same accordingly 32 The contractor shall make his own arrangement...
  • 16
  • 623
  • 0
Tài liệu INTERIOR/ FURNISHING & RENOVATION WORKS IN THE BRANCH OF BANK OF INDIA, BHULLAR , LUDHIANA ppt

Tài liệu INTERIOR/ FURNISHING & RENOVATION WORKS IN THE BRANCH OF BANK OF INDIA, BHULLAR , LUDHIANA ppt

Ngày tải lên : 16/02/2014, 11:20
... S Marked materials, the contractor shall arrange the same accordingly 32 The contractor shall make his own arrangement at his own cost for all general & special electrical tools & plants required ... thick glass with etching and frosting All exposed TW surfaces to be finished in melamine polish of matching laminate colour as directed including all necessary Stainless Steel finish fittings/ ... electrical conducting and at the bottom for the LAN cabling/Telephone wire conducting The item to include all necessary hardware and fittings in Stainless Steel finish, lipping to all edges and...
  • 24
  • 488
  • 0
Tài liệu Báo cáo khoa học: Limited suppression of the interferon-b production by hepatitis C virus serine protease in cultured human hepatocytes pptx

Tài liệu Báo cáo khoa học: Limited suppression of the interferon-b production by hepatitis C virus serine protease in cultured human hepatocytes pptx

Ngày tải lên : 18/02/2014, 16:20
... described in Fig 6C The black arrowhead indicates the noncleaved TRIF O cells A MycMyc- Cardif Cardif C5 0 8A 75 kDa 50 37 NS3 b-actin Oc cells B Myc-Cardif C5 0 8A Myc-Cardif (Strain) (1B-1) (O) (1B-1) ... sequences of sense and antisense primers for TRIF (accession no AB093555) were 5¢-AAGCCATGATGAGCAACCTC-3¢ and 5¢-GTGTCC TGTTCCTTCCTCCAC-3¢ The sequences of sense and antisense primers for RIG-I (accession ... H Dansako et al Cardif-mediated pathways are functional, such as PH5CH8 cells We clearly demonstrated that Cardif was cleaved by NS3-4As of 1B-1 and HCV-O strains obtained from healthy HCV carriers...
  • 16
  • 523
  • 0
Tài liệu Báo cáo khoa học: Extended half-life upon binding of destabilized intrabodies allows specific detection of antigen in mammalian cells pdf

Tài liệu Báo cáo khoa học: Extended half-life upon binding of destabilized intrabodies allows specific detection of antigen in mammalian cells pdf

Ngày tải lên : 19/02/2014, 18:20
... primers 5¢-ACTCATA CTAGTCTTAGCCATGGCTTCCCGCCG GCG-3¢ and 5¢-CCATCCGAATTCTCACTACACATTGATCCTAGCA GAAGC-3¢ were used for the PCR amplification of the C- terminal region of d1-EGFP corresponding to the ... 5¢-CTAGTCGTCCGAACTCCGATAATCGC CGTCAGGGCGGTCGCGAACGTTTAG-3¢ and 5¢-CA TGCCAAACGTTCGCGACCGCCCTGACGGCGATTA TCGGAGTTCGGACA-3¢ into the unique SpeI restriction site p13R4-DP was obtained by replacing the B10 tag of ... ethanol precipitation One microgram of the recovered DNA was used as template for the PCR duplex experiments The following primers 5¢-GTCTGGCGGAA AACCTCAGTGTGACGC-3¢ and 5¢-GACACCAGACCA ACTGGTAATGGTAGCGACCG-3¢...
  • 14
  • 483
  • 0
Báo cáo khoa học: Respective roles of the catalytic domains and C-terminal tail peptides in the oligomerization and secretory trafficking of human acetylcholinesterase and butyrylcholinesterase potx

Báo cáo khoa học: Respective roles of the catalytic domains and C-terminal tail peptides in the oligomerization and secretory trafficking of human acetylcholinesterase and butyrylcholinesterase potx

Ngày tải lên : 07/03/2014, 03:20
... suggesting a predominant in uence of the catalytic domains on oligomerization This may be due in part to the difference in N-glycosylation of AChE and BChE, which carry four and nine N-glycan chains, ... relationships and identification of a catalytically essential aspartic acid Proc Natl Acad Sci USA 88, 6647–6651 47 Grifman M, Galyam N, Seidman S & Soreq H (1998) Functional redundancy of acetylcholinesterase ... 200 Secreted activity AAa Aa S1 9C Aa S3 8C Ab Ab SSVGL Ab N1 9C Ab N1 9C N18S Ab N1 9C MD22VH Ab N1 9C N18S MD22VH BBa Ba S1 9C Bb Bb SSVGL Bb A1 2C Bb H1 5C Bb N1 9C Bb D2 3C Bb N2 6C Bb S3 7C Bb N1 9C N18S...
  • 15
  • 446
  • 0
Báo cáo khoa học: C fi G base mutations in the CArG box of c-fos serum response element alter its bending flexibility Consequences for core-SRF recognition potx

Báo cáo khoa học: C fi G base mutations in the CArG box of c-fos serum response element alter its bending flexibility Consequences for core-SRF recognition potx

Ngày tải lên : 07/03/2014, 09:20
... Ruiz-Chica AJ, Medina MA, Sanchez-Jiminez F & Ramirez FJ (2004) Characterization by Raman spectroscopy of conformational changes on guanine–cytosine and adenine–thymine oligonucleotides induced ... temperature-induced structural changes in the Raman spectra during premelting are mainly characterized, in SVD analysis, by variation in the V2 contribution of the spectral component S2 Actually, ... intensity standard in Raman spectroscopy of DNA [30] was used to determine the right scaling factor No scaling factor was used for subtraction of Raman spectra obtained for the same sample at various...
  • 16
  • 538
  • 0
Báo cáo khoa học: Kinetic deuterium isotope effects for 7-alkoxycoumarin O-dealkylation reactions catalyzed by human cytochromes P450 and in liver microsomes Rate-limiting C-H bond breaking in cytochrome P450 1A2 substrate oxidation pdf

Báo cáo khoa học: Kinetic deuterium isotope effects for 7-alkoxycoumarin O-dealkylation reactions catalyzed by human cytochromes P450 and in liver microsomes Rate-limiting C-H bond breaking in cytochrome P450 1A2 substrate oxidation pdf

Ngày tải lên : 16/03/2014, 13:20
... USA 13 Walsh C (1979) Enzymatic Reaction Mechanisms W.H Freeman Co, San Francisco, CA, USA 14 Miwa GT & Lu AYH (1987) Kinetic isotope effects and ‘metabolic switching’ in cytochrome P450-catalyzed ... 7-OMe coumarin have an advantage in that there is no issue with pro-chirality However, with both d1 7-OEt coumarin and d2 7-OMe coumarin some perturbation can occur because of a geminal secondary ... human liver microsomes Results and discussion Intramolecular kinetic isotope effects The intramolecular kinetic isotope effects measure the comparative rates for cleavage of a C- H bond and a C- D...
  • 9
  • 314
  • 0
Báo cáo khoa học: Differential involvement of protein kinase C alpha and epsilon in the regulated secretion of soluble amyloid precursor protein docx

Báo cáo khoa học: Differential involvement of protein kinase C alpha and epsilon in the regulated secretion of soluble amyloid precursor protein docx

Ngày tải lên : 23/03/2014, 13:20
... samples) was observed (Fig 1B) Activation of PKC was determined by examining translocation of cytosolic PKC to a particulate membrane fraction, because PKC activation involves a stable association ... MAP-kinase pathway [39] It was shown that MAP-kinase activation can be obtained downstream of muscarinic receptors by a mechanism involving the activation of Src tyrosine kinase [39] without involving ... increase in sAPPa release compared to basal levels and reached a maximum of approximately threefold increase at 100 nM PMA In contrast SYDe showed a slight and not significant increase in sAPPa release...
  • 8
  • 458
  • 0
Báo cáo khoa học: HIP/PAP, a C-type lectin overexpressed in hepatocellular carcinoma, binds the RIIa regulatory subunit of cAMP-dependent protein kinase and alters the cAMP-dependent protein kinase signalling ppt

Báo cáo khoa học: HIP/PAP, a C-type lectin overexpressed in hepatocellular carcinoma, binds the RIIa regulatory subunit of cAMP-dependent protein kinase and alters the cAMP-dependent protein kinase signalling ppt

Ngày tải lên : 23/03/2014, 13:20
... bovine heart PKA The sense primer (5¢-GTCGAATTCCAAGGTG AAGAACCCCAG-3¢) was located at nucleotides 63–90 of the coding sequence, and the antisense primer (5¢-TG CTGAATTCCCTCCCTCCTGCACTAGTCAG-3¢) ... mice expressing human HIP/ PAP in the liver, HIP/PAP enhances liver regeneration and acts as a hepatic cytokine that combines mitogenic and anti-apoptotic functions using pathways involving PKA ... proliferating ductules as well as by hepatocarcinoma and cholangiocarcinoma cells Am J Pathol 155, 1525–1533 Lasserre, C. , Colnot, C. , Brechot, C & Poirier, F (1999) HIP/PAP gene, encoding a C- type...
  • 9
  • 310
  • 0
Báo cáo Y học: Extra terminal residues have a profound effect on the folding and solubility of a Plasmodium falciparum sexual stage-specific protein over-expressed in Escherichia coli pptx

Báo cáo Y học: Extra terminal residues have a profound effect on the folding and solubility of a Plasmodium falciparum sexual stage-specific protein over-expressed in Escherichia coli pptx

Ngày tải lên : 23/03/2014, 21:20
... Pfg27E:5¢-AAAC TGCAGATGAGTAAGGTACAAAAG-3¢ and 5¢-AAAA GCTTTCACTTCGAATTCCATGGTACCAG-3¢ (PstIHindIII); Pfg27F: 5¢-AAACTGCAGATGAGTAAGGTA CAAAAG-3¢ and 5¢-AAAAAGCTTTTACGACGTTGT GTGATGTGGTTCATC-3¢ (PstI-HindIII) ... 5¢-AAAAAGC TTATGAGTAAGGTACAAAAG-3¢ and 5¢-AAAAAGC TTTTAAATATTGTTGTGATGTGGTTCATC-3¢ (HindIII); Pfg27D: 5¢-AAAGAATTCATGAGTAAGGTACA AAAG-3¢ and 5¢-AAACTGCAGTTAAATATTGTTGT GATGTGGTTCATC-3¢ (EcoRI-PstI); ... CTGCAGATGAGTAAGGTACAAAAG-3¢ and 5¢-AAA AAGCTTAATATTGTTGTGATGTGGTTCATC-3¢ (PstIHindIII); Pfg27B: 5¢-AAACTGCAGATGAGTAAGGTA CAAAAG-3¢ and 5¢-AAACTGCAGTTAAATATTGTTG TGATGTGGTTCATC-3¢ (PstI); Pfg2 7C: 5¢-AAAAAGC...
  • 5
  • 435
  • 0
Báo cáo Y học: Secretion of egg envelope protein ZPC after C-terminal proteolytic processing in quail granulosa cells doc

Báo cáo Y học: Secretion of egg envelope protein ZPC after C-terminal proteolytic processing in quail granulosa cells doc

Ngày tải lên : 24/03/2014, 03:21
... with a- cyano-4hydroxycinnamic acid (Aldrich Chemical) as a matrix In order to identify the C- terminal amino acid of ZPC, 18.5 lg of the purified ZPC as described above was applied directly to an automated ... trifluoroacetic acid at a flow rate of 1.0 mLÆmin)1 A peak at 6.1 (48% acetonitrile) was collected, and the N-terminal amino-acid sequence was confirmed as Ala318Arg-Asn-Thr-Trp-Val-Pro-Val-Glu-Gly327 ... Hosaka, M., Nagahama, M., Kim, W., Watanabe, T., Hatsuzawa, K., Ikemizu, J., Murakami, K & Nakayama, K (1991) Arg-XLys/Arg-Arg motif as a signal for precursor cleavage catalyzed by furin within...
  • 9
  • 300
  • 0
Báo cáo khoa học: Specific Ca2+-binding motif in the LH1 complex from photosynthetic bacterium Thermochromatium tepidum as revealed by optical spectroscopy and structural modeling pdf

Báo cáo khoa học: Specific Ca2+-binding motif in the LH1 complex from photosynthetic bacterium Thermochromatium tepidum as revealed by optical spectroscopy and structural modeling pdf

Ngày tải lên : 30/03/2014, 02:20
... as mCaCm (c, d) as mCaCm (a, b) mCbCb, s mCaCm (c) , mCN(III) s mCaCm (a) , mCN(II) CH3 bend, s mCaCm(d), mCN(IV) CH3 bend, C6 C16 mCN(I), dCmH (a, d), CH3 bend dCmH(d), CH3 bend mCN(III), dCmH(b), CH3 ... of Tch tepidum; purple, His coordinating to BChl a in the template; yellow, hydrogen atoms coordinating to BChl a; light blue: oxygen atoms coordinating to Ca2+ BChl a macrocycle induced by Ca2+ ... reveal a speci c Ca2+-coordination cavity that may induce configurational changes in the polypeptides, and, as a result, in BChl a molecules The results are discussed in terms of the long-wavelength...
  • 11
  • 392
  • 0
Báo cáo khoa học: Molecular identification and expression study of differentially regulated genes in the Pacific oyster Crassostrea gigas in response to pesticide exposure doc

Báo cáo khoa học: Molecular identification and expression study of differentially regulated genes in the Pacific oyster Crassostrea gigas in response to pesticide exposure doc

Ngày tải lên : 30/03/2014, 15:20
... 5¢-ATACCGTGACCTGACATCCGCTGGTGCT-3¢ 5¢-CCTTTTTAGCAGTGACTTTCCGTTGCAA-3¢ 5¢-TTGCAACGACTGCAGTCATCAGTAGGGT-3¢ 5¢-GGCCCGACGGGTGTCTCTCCAGACCCGT-3¢ 5¢-TAACCTCCAAAAACTTGCACGTCGGCAA-3¢ 5¢-GCACAGTTCCCCTACAGTCCCGCTTTAG-3¢ ... 5¢-CAGAGTGTGCACTAGCATGCGGTCCCGT-3¢ 5¢-AGGTGTCCTAGATACCGGCCATGTACCA-3¢ 5¢-TGCAATAATTTTTGAAGCCCCGG-3¢ 5¢-TTAGCATCTGTGGCCTCTGTGATTTGTCC-3¢ 5¢-GCCCCTACCATAACATAGAGGACCCCTGG-3¢ 5¢-CAAATCTACCTGCACGAGCCACTCTGTGC-3¢ ... 5¢-ATCTGGAGAGCACATCATTGCTGGTGCA-3¢ 5¢-ACATCGAGGAAGAGTTTTCTATCCTGGA-3¢ 5¢-ACATCGCTGAGAATGTCAACGGGGATAT-3¢ 5¢-CTTTCTGGCCTCTCCAACATCCATGCCA-3¢ 5¢-ATGCCAAGGTAGTTTATGATGATCGAGA-3¢ 5¢-TCTCCTACGATCATCTCACCGTCACCGA-3¢...
  • 14
  • 413
  • 0
báo cáo sinh học:" Scaling up kangaroo mother care in South Africa: ''''on-site'''' versus ''''off-site'''' educational facilitation" ppt

báo cáo sinh học:" Scaling up kangaroo mother care in South Africa: ''''on-site'''' versus ''''off-site'''' educational facilitation" ppt

Ngày tải lên : 18/06/2014, 17:20
... key factors In any scaling-up programme that is accompanied by education and training, health administrators have to decide which venue for face-to-face facilitation is most feasible and accessible ... health centres and hospitals Four initiatives are currently under way – kangaroo mother care (KMC), basic antenatal care, basic intrapartum care and essential steps in postpartum care The focus ... that face-to-face facilitation is effective in the scaling up of new health care strategies Secondly, the finding in this study indicates that it is not crucial whether the face-to-face facilitation...
  • 6
  • 392
  • 0
Báo cáo sinh học: " Transmission of human hepatitis C virus from patients in secondary cells for long term culture" pot

Báo cáo sinh học: " Transmission of human hepatitis C virus from patients in secondary cells for long term culture" pot

Ngày tải lên : 19/06/2014, 08:20
... gtc ttc acg cag cac tcg caa cca ccc tat cag act gtc ttc acg cag aag cgt cta gcc at cga gac ctc ccg ggg cac tcg caa gca ccc acg cag aaa gcg tct agc cat ggc gtt agt tcc cgg ggc act cgc aag cac cct ... HCV 10.2 HCV HCV HCV HCV HutLA2 positive positive positive positive negative negative negative negative positive gac act cca cca tag atc act c cat gat gca cgc tct acg aga c ctg tga gga act act ... and African Americans The uninfected controls were from Caucasians, Hispanics, and African-American The participants included 108 males and 48 females All specimens were freshly processed within...
  • 17
  • 479
  • 0
Báo cáo hóa học: "Research Article Polarimetric Kronecker Separability of Site-Specific Double-Directional Channel in an Urban Macrocellular Environment" pptx

Báo cáo hóa học: "Research Article Polarimetric Kronecker Separability of Site-Specific Double-Directional Channel in an Urban Macrocellular Environment" pptx

Ngày tải lên : 21/06/2014, 22:20
... fact that extracted channel parameters are independent of the measurement antennas since the beam patterns of the measurement antennas are taken into account in the multipath parameters extraction ... existence Obtain the joint angular PSD between the BS and MS according to (22) and (26) Generate random phases Obtain the single channel polarization-pair MIMO channel according to (24) Obtain the ... Sivasondhivat, J.-I Takada, I Ida, and Y Oishi, “Experimental analysis and site-speci c modeling of channel parameters at mobile station in an urban macrocellular environment,” IEICE Transactions...
  • 15
  • 318
  • 0
Underground works in hard rock tunnelling and mining ppsx

Underground works in hard rock tunnelling and mining ppsx

Ngày tải lên : 11/07/2014, 15:20
... different and the critical crack density is reached at stress values that are considerably less than the laboratory value In the limit, the critical crack interaction becomes coincident with crack initiation ... sample from a stressed rock mass induces a stress concentration at the sampling point When this stress concentration is sufficient, grain-scale microcracking occurs and the accumulation and growth ... sufficiently high, preventing unstable crack or fracture coalescence (e.g., in confined cylindrical test samples) Unravelling Figure 2.14: Schematic diagram illustrating preferential crack propagation...
  • 88
  • 252
  • 0
Underground works in soils and soft rock tunnnelling doc

Underground works in soils and soft rock tunnnelling doc

Ngày tải lên : 11/07/2014, 15:20
... durable increases in the mechanical characteristics of grouted soils to be obtained, which was practically impossible with conventional products An interesting application case of mineral based grout, ... decision aid systems, based on the statistical evaluation of geological data (Sinfield and Einstein, 1996) could assist the engineer in achieving a more accurate appreciation of construction hazards ... feature of this approach was to introduce the influence of an increase in undrained shear strength with depth, which can usually not be accounted for with analytical solutions A similar approach...
  • 49
  • 532
  • 0
Báo cáo lâm nghiệp: "Solar activity, global surface air temperature anomaly and pacific decadal oscillation recorded in urban tree rings" pot

Báo cáo lâm nghiệp: "Solar activity, global surface air temperature anomaly and pacific decadal oscillation recorded in urban tree rings" pot

Ngày tải lên : 07/08/2014, 16:21
... cross-correlations of STD and local climate factors are also significant (Tab IIIB) 3.2 Relations between local climate and large scale climatic and environmental factors The local climate was strongly in uenced ... embedded in STD and GSATA indicates that GSATA is a more complex interior abnormity of Earth system It has sensitive and unstable characteristics, and probably had multi-scale in uence from local climatic ... key climatic factor a ecting high latitude regional climate of north hemisphere, Siberian climatic variables (such as cold snap) heavily a ected the climatic variables in Shenyang in the past Therefore,...
  • 14
  • 348
  • 0

Xem thêm