0

c geting ready for school

unit 4. BIG  OR  SMALL   leson 6. C. Getting ready for school(4-7)

unit 4. BIG OR SMALL leson 6. C. Getting ready for school(4-7)

Tiếng anh

... Thu’s school? 8. How many students are there in Thu’s school ?9. LN- Call on some pairs to practice in the class.- Get feedback.- Check up and correct their predictions .* Phong’s school ... feedback.4. Production . (10’)“Word cue drill”- Give instruction and check.- Ask Ss to use the cue in C4 on page 19 and work in pair to practice.- Let them have time to practice.- Call ... and things at school. 19m c thÞ söu English 6 n¨m h c; 2008 – 2009 How are you ?I’m fine, thanks.* Concept check: meaning, form, usage and pronunciation.3. Practice . (15’)* Picture drill.-...
  • 76
  • 3,078
  • 6
C++ Basics - Functions for All Subtasks

C++ Basics - Functions for All Subtasks

Kỹ thuật lập trình

... so we concentrate on the price functionpseudocode for the price functionIf turnover <= 7 days then return (cost + 5% of cost);else return (cost + 10% of cost);Slide 5- 35Copyright ... function callCall-by-reference parameters allow us to changethe variable used in the function callArguments for call-by-reference parameters must bevariables, not numbersSlide 5- 18Copyright ... Education, Inc. Publishing as Pearson Addison-WesleyUsing Procedural AbstractionFunctions should be designed so they can be used as black boxesTo use a function, the declaration and commentshould...
  • 65
  • 476
  • 0
Games (for 3+4) ( things for school).ppt

Games (for 3+4) ( things for school).ppt

Tư liệu khác

... 1LUCKY2TopicTopic : THINGS FOR SCHOOL B A G 8 CHECK VOCABULARY 1LUCKY2TopicTopic : THINGS FOR SCHOOL R U L E R5 1LUCKY2TopicTopic : THINGS FOR SCHOOL P E N7 1LUCKY2TopicTopic ... 1LUCKY2TopicTopic : THINGS FOR SCHOOL P E N C I L2 1LUCKY2TopicTopic : THINGS FOR SCHOOL E R A S E R3 1LUCKY2TopicTopic : THINGS FOR SCHOOL B O O K4 1LUCKY2TopicTopic : THINGS FOR SCHOOL D...
  • 10
  • 458
  • 9
Building C++CLI Programs for the .NET Developer Platform with Visual C++

Building C++CLI Programs for the .NET Developer Platform with Visual C++

Kỹ thuật lập trình

... mode, except for the code in Chapter 12, which deals specifically with unverifiable code, and code that uses specific constructs such as unsafe uses of static_cast. If you’re familiar with C# , ... any specific processor architecture. However, as you’ve seen, code compiled with /clr rather than /clr:pure or /clr:safe may contain plat-form-specific code. Also, even in pure mode, you can invoke ... compiler (or cross-compiler) for that architecture. Visual C+ + 2005 ships cross-compilers for x64 and Intel Itanium architectures, so you can generate code on an x86 computer that will execute...
  • 14
  • 485
  • 0
Tài liệu Is Your Network Ready for GPON? docx

Tài liệu Is Your Network Ready for GPON? docx

Phần cứng

... LCC-13-BE LCC-26-BE LCC-31-BEbulk (100 pack) LCC-1B-BE LCC-13B-BE LCC-26B-BE LCC-31B-BECrimp ToolsFeatures ergonomic handle for ADC die sets WT-2Features long ergonomic handle for ADC die sets ... Analog Video SHDC-LCCHigh-Performance, HD SHDC-LCC-HPStraight-Through High-Performance, HD SHDC-LCC-NN1.0/2.3 connectors Normalling AES and Analog Video SHDC-1023High-Performance SHDC-1023-HPStraight-Through ... High-Performance SHDC-1023-NNOrdering InformationDescription Catalog NumberLCP High-Performance Patch Cords2 feet BK2VXM-LCP-LCP3 feet BK3VXM-LCP-LCP4 feet BK4VXM-LCP-LCP6 feet BK6VXM-LCP-LCPOrdering...
  • 8
  • 414
  • 0
Tài liệu KRONE - Guide - Is your Cabling System ready for VoIP ppt

Tài liệu KRONE - Guide - Is your Cabling System ready for VoIP ppt

Quản trị mạng

... frequentlychecked during installation by the endorsed installercompany for practices which may contribute tonon-compliance and then tested before hand-overto ensure compliance with the relevant specificationin ... inbetween the switch and network connectionsinside the Telecommunications Room. Note: Beaware that some computer Network InterfaceCards (NIC) cannot tolerate voltage oncommunication pairs.External ... specificationin the building contract. For IP Telephony to be successfully implemented;1. All four pairs of the cable must be connectedin a structured cabling system.2. The network cabling...
  • 4
  • 376
  • 0
  c# 2010 AIO for dummies

c# 2010 AIO for dummies

Kỹ thuật lập trình

... Concept #2: Classi cation 209Why Classify? 210Object-Oriented Concept #3: Usable Interfaces 211Object-Oriented Concept #4: Access Control 212How C# Supports Object-Oriented Concepts 212Chapter ... Dummies.com*Sweepstakes not currently available in all countries; visit Dummies.com for official rules.Get More and Do More at Dummies.com®To access the Cheat Sheet created specifically for this ... III: Designing for C# 399Chapter 1: Writing Secure Code 401Chapter 2: Accessing Data 415Chapter 3: Fishing the FileStream 435Chapter 4: Accessing the Internet 455Chapter 5: Creating Images...
  • 867
  • 4,334
  • 0
Tài liệu Communicable Diseases Summary: A Guide for School Health Services Personnel, Child Care Providers and Youth Camps doc

Tài liệu Communicable Diseases Summary: A Guide for School Health Services Personnel, Child Care Providers and Youth Camps doc

Sức khỏe trẻ em

... 16Staphylococcal Infection 28Strep Throat See Streptococcal InfectionStreptococcal Infection 29Streptococcus pneumoniae See Pneumococcal DiseaseSyphilis 29TB (Tuberculosis) 30Tickborne Illnesses ... section for “Varicella zoster virus:Chickenpox”.][Also, see SHS “Guide for Emergency Care inMaryland Schools, 2005”section for “Rashes”.]Communicable Diseases Summary: Guide for Schools, Child ... abuse.[Also, see SHS “Guide for Emergency Care inMaryland Schools, 2005”section for “Child Abuseand Neglect”.]Communicable Diseases Summary: Guide for Schools, Child Care, and Youth CampsMaryland Department...
  • 36
  • 458
  • 1
Tài liệu Managing asthma A Guide for Schools pptx

Tài liệu Managing asthma A Guide for Schools pptx

Sức khỏe giới tính

... of classmates who have asthma.Actions for the School NurseMANAGING ASTHMA: A GUIDE FOR SCHOOLSiv School Education SubcommitteeLani S. Wheeler, M.D., F.A.A.P., F.A.S.H.A. (Chair)American School ... in accordance with school policy and State mandates. Provide easy access to emergency medications. Support self-administration when appropriate. Consult medical and State Nurse Practice Acts ... asthma  School policies and procedures for administering medications, including protocols for emergency response to a severe asthma episode Specific actions for staff members to perform in...
  • 44
  • 636
  • 0
Tài liệu First Principles: Designing Effective Education Programs for School Health in Developing Countries doc

Tài liệu First Principles: Designing Effective Education Programs for School Health in Developing Countries doc

Sức khỏe giới tính

... Existence of national-level school environment (inspection) standards3. Percentage of schools with a safe, sufcient, and accessible water supply4. Percentage of schools with sufcient, accessible, ... national-level curricula for primary and secondary schools 2. Generic and content-speci c life skills concepts and themes explicitly assessed in national-level school- leaving examinations
  • 28
  • 454
  • 0
Tài liệu Teacher Training: Essential for School-Based Reproductive Health and HIV/AIDS Education docx

Tài liệu Teacher Training: Essential for School-Based Reproductive Health and HIV/AIDS Education docx

Sức khỏe giới tính

... Thesefactors make young people reluctant to con-fide in their teachers.Chapter 5. Teacher SelectionTeacher Selection Criteria ChecklistThe following checklist of selection criteria can assist ... Impact 6Chapter 3. African Setting Poses Challenges 8Chapter 4. Teacher Training Projects in Africa 12Chapter 5. Teacher Selection 17Chapter 6. Assessing Teacher Training Curricula 18Chapter ... who care for HIV-infected persons.Management and StructureThe curriculum should include information onthe structure of the school environment,resources available within the school and com-munity,...
  • 29
  • 454
  • 0
Prevention and Control of Communicable Diseases: A Guide for School Administrators, Nurses, Teachers, Child Care Providers, and Parents or Guardians pptx

Prevention and Control of Communicable Diseases: A Guide for School Administrators, Nurses, Teachers, Child Care Providers, and Parents or Guardians pptx

Sức khỏe trẻ em

... Control of Communicable Diseases, A Guide for School Administrators, Nurses, Teachers, and Child Care Providers”. DISCLAIMER - In clinical practice, certain circumstances ... disinfecting; guidelines for specific items commonly used in the childcare and school setting; and a checklist for choosing a disinfectant other than bleach. Definitions Cleaning Mechanical ... products can be used in childcare and school settings. Green sanitizers or disinfectants must be approved by your local public health agency or your childcare consultant. For more information,...
  • 247
  • 706
  • 1
Guidelines for School Programs To Prevent Skin Cancer docx

Guidelines for School Programs To Prevent Skin Cancer docx

Sức khỏe giới tính

... Association for Health Education;* American Cancer Society;* AMCCancer Research Center and Foundation;* American Optometric Association;* American Pharmaceutical Association;* American School Health ... other school staff (e.g., coaches and school nurses). Skin cancer prevention can be integrated intothese activities.All school staff should receive basic information concern-ing the importance ... McAlpine BE. Personal andclinical skin cancer prevention practices of U.S. women physicians.Arch Derm 2000;136:633–42.60. McDonald CJ. American Cancer Society perspective on the AmericanCollege...
  • 24
  • 446
  • 0
PERIPHERAL BLOOD BASED C-PCR ASSAY FOR DIAGNOSING EXTRA-PULMONARY TUBERCULOSIS pdf

PERIPHERAL BLOOD BASED C-PCR ASSAY FOR DIAGNOSING EXTRA-PULMONARY TUBERCULOSIS pdf

Sức khỏe giới tính

... was: Forward primer (FW) 5- TCCGCTGCCAGTCGTCTTCC-3 and Reverse primer (RW) 5- GTCCTCGCGAGTCTAGGCCA – 3. Amplification reaction was performed in 25 l of master cocktail containing ... quantification of mycobacterial Fig. 6—Representative agarose gel electrophoresis picture(s) of C- PCR amplified products for the calculation of mycobacterial load from peripheral blood specimens ... used specimen for revealing the presence of tubercle bacilli in TB. However, its clinical significance in EPTB is very discouraging3. The diagnosis in such cases posses great challenge...
  • 7
  • 308
  • 0

Xem thêm

Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc hệ số công suất cosp fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25