c and a script

Báo cáo hóa học: " Nanoscratch Characterization of GaN Epilayers on c- and a-Axis Sapphire Substrates" doc

Báo cáo hóa học: " Nanoscratch Characterization of GaN Epilayers on c- and a-Axis Sapphire Substrates" doc

Ngày tải lên : 21/06/2014, 08:20
... original author(s) and source are credited Table Critical lateral forces and values of l determined from nanoscratch trace depths within GaN films on c- and a- axis sapphire substrates Sample Normal ... tribological and chemical effects, rather than physical deformation and fracture, are believed to become dominant In this scenario, the average measured residual stress in the cracking zone is much ... the dislocation recovery from elastic and/ or plastic deformation appear to be associated with the activation of dislocation sources brought about by the nanoscratching of the Nanoscale Res Lett...
  • 5
  • 276
  • 0
AN1113   using c and a hardware module to interface 8051 MCUs with i2c™ serial EEPROMs

AN1113 using c and a hardware module to interface 8051 MCUs with i2c™ serial EEPROMs

Ngày tải lên : 11/01/2016, 16:45
... DS01113B-page 13 WORLDWIDE SALES AND SERVICE AMERICAS ASIA/PACIFIC ASIA/PACIFIC EUROPE Corporate Office 2355 West Chandler Blvd Chandler, AZ 85224-6199 Tel: 480-792-7200 Fax: 480-792-7277 Technical ... Data (n + 2) P SDA Line Bus Activity © 2008 Microchip Technology Inc A C K A C K A C K A C K N A C K DS01113B-page AN1113 INITIALIZATION START DATA TRANSFER Initialization consists of initializing ... Device Address T S1 010 AAA0 MSB Address Byte S T O P Data Byte S 1 A A A1 A C K A C K Bus Activity S T A Control Byte/ R Device Address T LSB Address Byte A C K P N A C K A C K PAGE WRITE OPERATION...
  • 14
  • 273
  • 0
AN1234   using c and a hardware module to interface texas instruments MSP430XXXX MCUs with SPI serial EEPROMs

AN1234 using c and a hardware module to interface texas instruments MSP430XXXX MCUs with SPI serial EEPROMs

Ngày tải lên : 11/01/2016, 17:02
... DS0123 4A- page 15 WORLDWIDE SALES AND SERVICE AMERICAS ASIA/PACIFIC ASIA/PACIFIC EUROPE Corporate Office 2355 West Chandler Blvd Chandler, AZ 85224-6199 Tel: 480-792-7200 Fax: 480-792-7277 Technical ... on recycled paper Microchip received ISO/TS-16949:2002 certification for its worldwide headquarters, design and wafer fabrication facilities in Chandler and Tempe, Arizona; Gresham, Oregon and ... Trademarks The Microchip name and logo, the Microchip logo, Accuron, dsPIC, KEELOQ, KEELOQ logo, MPLAB, PIC, PICmicro, PICSTART, rfPIC, SmartShunt and UNI/O are registered trademarks of Microchip...
  • 14
  • 315
  • 0
AN1251 using HI TECH c® and a timer to interface mid range PIC MCUs with UNIO® serial EEPROMs

AN1251 using HI TECH c® and a timer to interface mid range PIC MCUs with UNIO® serial EEPROMs

Ngày tải lên : 11/01/2016, 17:03
... DS0125 1A- page 15 WORLDWIDE SALES AND SERVICE AMERICAS ASIA/PACIFIC ASIA/PACIFIC EUROPE Corporate Office 2355 West Chandler Blvd Chandler, AZ 85224-6199 Tel: 480-792-7200 Fax: 480-792-7277 Technical ... DS0125 1A- page 10 0 0 0 0 © 2009 Microchip Technology Inc AN1251 SEQUENTIAL READ Command and Word Address for Read The serial EEPROM allows data to be read from the array in a random access manner Reading ... on recycled paper Microchip received ISO/TS-16949:2002 certification for its worldwide headquarters, design and wafer fabrication facilities in Chandler and Tempe, Arizona; Gresham, Oregon and...
  • 16
  • 246
  • 0
Tài liệu Debugging C and C++ code in a Unix environment ppt

Tài liệu Debugging C and C++ code in a Unix environment ppt

Ngày tải lên : 21/01/2014, 06:20
... static analysis early; see the section called Using the compiler’s features Explicit storage allocation and deallocation In C and C+ +, you have to explicitly allocate and deallocate dynamic storage ... the causes of problems with C and C+ + code, is the policy of requiring explicit allocation and deallocation of dynamic storage (malloc(2) and free(2) (C) or new and delete (C+ +)) As C and C+ + ... 21 Chapter Aspects of debugging C and C+ + code System call tracers A system call tracer is a program that allows you to see what system calls (including parameters and return values) a process...
  • 29
  • 466
  • 1
Tài liệu Báo cáo khoa học: Verprolin function in endocytosis and actin organization Roles of the Las17p (yeast WASP)-binding domain and a novel C-terminal actin-binding domain doc

Tài liệu Báo cáo khoa học: Verprolin function in endocytosis and actin organization Roles of the Las17p (yeast WASP)-binding domain and a novel C-terminal actin-binding domain doc

Ngày tải lên : 18/02/2014, 16:20
... 4118 Arp2 ⁄ complex De novo actin filament assembly is critical for actin-patch formation at polarized cortical sites [29] Because cortical actin patches are short-lived structures, continual actin-patch ... polyclonal GFP-speci c antiserum was a gift from J Kahana and P Silver (Dana Farber Cancer Center, Boston, MA) The anti-actin mAb was MAB1501 from Chemicon International (Temecula, CA) The anti-hexokinase ... C- Vrp1p364)817 charged-cluster residues K485R486 are essential for cortical actin-patch polarization Cortical actin-patch polarization in vrp1D (AMY88) cells carrying YCplac111 vector (vect), pAM236 expressing...
  • 23
  • 679
  • 0
The Project Gutenberg EBook of The Car of Destiny by C. N. Williamson and A. M. Williamson pot

The Project Gutenberg EBook of The Car of Destiny by C. N. Williamson and A. M. Williamson pot

Ngày tải lên : 07/03/2014, 11:20
... without making myself ridiculous by a foreign accent As for my brown face and black eyes, many a Cornishman has a face as brown and eyes as black; therefore, I edited the name of Triana into Cornish ... sits always in the tonneau, had already heard all about the King's automobile, and was primed with particulars He leaned across to describe its appearance, as well as mention the make; and when ... and went alone, rather than drag Dick into an affair which might end disagreeably I did not put myself forward, but stood for a while and watched the dancers, waiting for my chance Carmona had...
  • 424
  • 1.3K
  • 0
C++?? A Critique of C++ and Programming and Language pot

C++?? A Critique of C++ and Programming and Language pot

Ngày tải lên : 08/03/2014, 23:20
... data in a class can also be divided into characteristic interface data which should be visible, and implementation 3rd Edition data which should be hidden Interface data are any characteristics ... hardware of many machines cater for such basic data types as character and integer, and it is probable that a compiler will generate code that is optimal for any target hardware architecture ... guaranteed, but static type checks can reject a class of programs that are otherwise type valid List classes are an example of where static type checking can reject a valid program A list class...
  • 63
  • 511
  • 0
Báo cáo khoa học: Biochemical properties of the human guanylate binding protein 5 and a tumor-specific truncated splice variant Mark Wehner and Christian Herrmann doc

Báo cáo khoa học: Biochemical properties of the human guanylate binding protein 5 and a tumor-specific truncated splice variant Mark Wehner and Christian Herrmann doc

Ngày tải lên : 15/03/2014, 10:20
... hGBP1 and other large GTPases, we analysed the enzymatic activity of hGBP 5a ⁄ b and hGBP5ta in a concentration-dependent manner Various concentrations of purified hGBP 5a ⁄ b and hGBP5ta were incubated ... reflecting larger structural changes accompanying nucleotide binding The rate constants for nucleotide association and dissociation are both much smaller for hGBP5 compared to hGBP1, reflecting a ... showed an antiviral effect against speci c viruses [10,11], and an anti-Chlamydia effect [12], inhibition of endothelial cell proliferation [13] and their subcellular localization [14] have also...
  • 9
  • 462
  • 0
Báo cáo khoa học: The proximity between C-termini of dimeric vacuolar H+-pyrophosphatase determined using atomic force microscopy and a gold nanoparticle technique ppt

Báo cáo khoa học: The proximity between C-termini of dimeric vacuolar H+-pyrophosphatase determined using atomic force microscopy and a gold nanoparticle technique ppt

Ngày tải lên : 16/03/2014, 02:20
... was cloned into the yeast expression vector pYES2 (Invitrogen, Carlsbad, CA, USA), 4390 and the two synthesized oligonucleotides Phis (5Â-CCTCG AGCCATCATCATCATCATCATTAGGGCCGCATCAT GTAATTAGTTATGT-3Â) ... (Digital Instruments, Santa Barbara, CA, USA) and a Picoplus instrument (Molecular Imaging, MI, USA) Muscovite mica (Electron Microscopy Sciences, Hateld, PA, USA) was freshly cleaved and immediately ... electrotransblotting apparatus (Nova Blot, Amersham Pharmacia Biotech, Piscataway, NJ, USA) The blots were incubated with the rabbit polyclonal antibody raised against the MAP (Mitogen-activated...
  • 14
  • 332
  • 0
Báo cáo khoa học: Conformational properties of bacterial DnaK and yeast mitochondrial Hsp70 Role of the divergent C-terminal a-helical subdomain pdf

Báo cáo khoa học: Conformational properties of bacterial DnaK and yeast mitochondrial Hsp70 Role of the divergent C-terminal a-helical subdomain pdf

Ngày tải lên : 16/03/2014, 22:20
... KKCC and KCCC chimeras were amplified by PCR from their corresponding yeast expression vectors [18], using the primers: 5¢-CCCGCCATGGGTAAAATAATTGGTA TCG-3¢ and 5¢-CCCGGATCCAAGCTTTTACTGCTTAG TTTCACCAGA-3¢ ... structure and specificity A B Fig Refolding activity of natural and chimeric Hsp70s in the presence of bacterial or mitochondrial co-chaperones Reactivation of GdnHCl-denatured (A) or heat-treated ... respectively) and a nucleotide exchange factor (GrpE and Mge1p) Despite these similarities, DnaK and mtHsp70 are speci c and cannot be exchanged between E coli and S cerevisiae mitochondria [18,19] Although...
  • 13
  • 349
  • 0
Báo cáo khoa học: Detection and characterization of a novel extracellular fungal enzyme that catalyzes the specific and hydrolytic cleavage of lignin guaiacylglycerol b-aryl ether linkages pdf

Báo cáo khoa học: Detection and characterization of a novel extracellular fungal enzyme that catalyzes the specific and hydrolytic cleavage of lignin guaiacylglycerol b-aryl ether linkages pdf

Ngày tải lên : 17/03/2014, 03:20
... the localization of the b-aryl ether cleavage activity, we prepared a hyphae fraction (HP), an extracellular fraction (EC), a cytoplasmic fraction (CY) and a membrane fraction (M) from cultures ... enzymatic reaction was a hydrolytic reaction or an oxidative reaction, the enzymic activity Fig Localization of b-aryl ether cleavage function and assay for highmolecular mass lignin structure (A) ... indicated that the b-aryl ether cleavage enzyme accumulated and was stable in the extracellular fraction The extracellular fraction of 2BW-1 generated abundant GG and 4MU from GOU by cleaving...
  • 10
  • 670
  • 0
Aaron r  bradley   programming for engineers  a foundational approach to learning c and matlab

Aaron r bradley programming for engineers a foundational approach to learning c and matlab

Ngày tải lên : 19/03/2014, 14:05
... elements (argc) and the actual array (argv) We introduce arrays and strings in Chapter and use them extensively in practice Saving this code in file sum .c and compiling it with the command gcc -Wall ... programs Rather than taking an abstract and rule-based perspective, this chapter covers the program stack and the function call protocol, which naturally give rise to these concepts A mechanistic ... plates in a cafeteria One can push data (plates) onto the stack and pop data (plates) off the stack In both cases, the operations a ect only the top of the stack Similarly, stack frames are pushed...
  • 250
  • 655
  • 0
Báo cáo Y học: Cytochrome c from a thermophilic bacterium has provided insights into the mechanisms of protein maturation, folding, and stability potx

Báo cáo Y học: Cytochrome c from a thermophilic bacterium has provided insights into the mechanisms of protein maturation, folding, and stability potx

Ngày tải lên : 24/03/2014, 03:21
... the cytoplasmic holo-(TT c- 552) has the same function and spectra as the authentic one, the cytoplasmic soluble protein fraction also contains a minor product, which has a heme attached covalently ... S.J (1996) Alteration of haem-attachment and signal-cleavage sites for Paracoccus denitrificans cytochrome c5 50 probes pathway of c- type cytochrome biogenesis in Escherichia coli Mol Microbiol 19, ... cytoplasmic products also appears to indicate that the heme attachment itself is not catalyzed enzymatically CONCLUSIONS AND PERSPECTIVE Highly homologous monoheme Class I cytochromes c are available...
  • 7
  • 369
  • 0
Báo cáo khoa học: MicroRNA-23b mediates urokinase and c-met downmodulation and a decreased migration of human hepatocellular carcinoma cells doc

Báo cáo khoa học: MicroRNA-23b mediates urokinase and c-met downmodulation and a decreased migration of human hepatocellular carcinoma cells doc

Ngày tải lên : 29/03/2014, 23:20
... cell extracts from control cells (lanes 1, 2, 4, and 5) and transfected cells (lanes and 6) at 48 and 72 h after transfection results showed a greater decrease in luciferase activity as compared ... hours and 72 h after transfection, total RNA isolations from control cells (lanes 1, 2, 4, and 5) and transfected cells (lanes and 6) were examined by RT-PCR to detect uPA mRNA (A) and c- met mRNA ... using RNU66 as an internal control RT-PCR analysis (Agilent) and real-time PCR Total RNA of transfected and nontransfected cells was extracted with Trizol reagent according to the manufacturer’s...
  • 17
  • 287
  • 0
Báo cáo khoa học: Disorder–order transition of k CII promoted by low concentrations of guanidine hydrochloride suggests a stable core and a flexible C-terminus doc

Báo cáo khoa học: Disorder–order transition of k CII promoted by low concentrations of guanidine hydrochloride suggests a stable core and a flexible C-terminus doc

Ngày tải lên : 30/03/2014, 20:20
... http://www.nov agen.com/SharedImages/TechnicalLiterature/7_tb055.pdf Datta, A. B., Chakrabarti, P., Subramanya, H.S & Parrack, P (2001) Purification and crystallization of CII: an unstable transcription activator ... (1998) The Escherichia coli RNA polymerase alpha subunit and transcriptional activation by bacteriophage lambda CII protein Acta Biochim Pol 45, 271–280 Kobiler, O., Koby, S., Teff, D., Court, D & ... Oppenheim, A. B (2002) The phage CII transcriptional activator carries a C- terminal domain signaling for rapid proteolysis Proc Natl Acad Sci USA 99, 14964–14969 Novagen (2002) pET System Manual, 10th...
  • 8
  • 422
  • 0
Báo cáo hóa học: " Non coding extremities of the seven influenza virus type C vRNA segments: effect on transcription and replication by the type C and type A polymerase complexes" ppt

Báo cáo hóa học: " Non coding extremities of the seven influenza virus type C vRNA segments: effect on transcription and replication by the type C and type A polymerase complexes" ppt

Ngày tải lên : 20/06/2014, 01:20
... AGCAGUAGCAAGAGGAUUUUUUCAUUUAAUGGAAUAACAAAAAUAUGUGCAAGUAGGAGGAAAGGGUUUAACAG CCCCUCC(UCA) AGCAGUAGCAAGGGGAUUUUUUCUUAUAAUGA(UCA) AGCAGUAGCAAGGGGAUUUUUGUUUUUUAUAAAACUGUACAAAAUAUUGACCAACACAUUAUCCAUUUUUCAAAA ... AGCAGUAGCAAGAGGAUUUUUAGUUAGACAUCUUUAUCUUUUUCACAUUCUUAUUUACAUCGCUUGAUGC A GCCCUUUGUGAGGCUUA AGCAGUAGCAAGAGGAUUUUUAGUUAGACAUCUUUUA AGCAGUAGCAAGAGGAUUUUUAGUUAGACUUA AGCAGUAGCAAGAGGAUUUUUAGCAAGACCUA AGCAGUAGCAAGAGGAUUUUUAGUUUA ... AGCAGUAGCAAGGGGAUUUUUGUUUUUUAUAAAACUGUACAAAAUAUUGACCAACACAUUAUCCAUUUUUCAAAA UUGUCUCAA(UCA) AGCAGUAGCAAGGAGAUUUUUGAAUUAUAUAUAGCAAUACAACAGUUGAUCAUAAAAUGUGCGAUGAAUUUAAUC UGACUUUAAUUUUCUCCAGGAAUGUUG(CUA) AGCAGUAGCAAGGGGAUUUUUUCAAGGUAA(UUA) AGCAGGAGCAAGGGGUUUUUUAACUUUGGAAUAACAACUUAAAACAA(UUA)...
  • 11
  • 427
  • 0
Simpo PDF Merge and Split Unregistered Version - http://www.simpopdf.com CONTENTS CONTENTS C H A P pdf

Simpo PDF Merge and Split Unregistered Version - http://www.simpopdf.com CONTENTS CONTENTS C H A P pdf

Ngày tải lên : 27/06/2014, 14:20
... Indian standard designation carbon–manganese free Table 2.7 Indian standard designation of carbon and carbon–manganese free cutting steels art (Reaffirmed according (Par according to IS:1570 (Part ... shock and impact resistance along with good machinability, such as hydraulic cylinders, cylinder heads, rolls for rolling mill and centrifugally cast products According to Indian standard specification ... includes unidirectional and reciprocating motions (b) Curvilinear motion which includes rotary, oscillatory and simple harmonic (c) Constant velocity (d) Constant or variable acceleration Selection...
  • 1.2K
  • 526
  • 0
Báo cáo lâm nghiệp: "C and 15 N isotopic fractionation in trees, soils and fungi in a natural forest stand and a Norway spruce plantation" pps

Báo cáo lâm nghiệp: "C and 15 N isotopic fractionation in trees, soils and fungi in a natural forest stand and a Norway spruce plantation" pps

Ngày tải lên : 07/08/2014, 16:21
... the natural stand: Cortinarius, Russula and Amanita, Breuil forest (mean and standard deviation for each species) C albo = Cortinarius alboviolaceus, C ano = C anomalus, C bol = C bolaris, C del ... stand, mean and standard deviation for each genus: Ama = Amanita, Bol = Boletus, Cant = Cantharellus, Cor = Cortinarius, Hyd = Hydnum, Hyg = Hygrophorus, Lac = Laccaria, Lact = Lactarius, Rus ... Cantharellus, Chal = Chalciporus, Clav = Clavulina, Cor = Cortinarius, Gom = Gomphidus, Lac = Laccaria, Lact = Lactarius, Pax = Paxillus, Rus = Russula, Scl = Scleroderma, Xer = Xerocomus genus Chalciporus,...
  • 11
  • 319
  • 0
Báo cáo lâm nghiệp: "The effects of lifting on mobilisation and new assimilation of C and N during regrowth of transplanted Corsican pine seedlings. A dual 13C and 15N labelling approach" docx

Báo cáo lâm nghiệp: "The effects of lifting on mobilisation and new assimilation of C and N during regrowth of transplanted Corsican pine seedlings. A dual 13C and 15N labelling approach" docx

Ngày tải lên : 08/08/2014, 01:22
... water and N entry, through decreased stomatal conductance and increased allocation of N As a consequence, C assimilation, carbohydrate concentration, and N availability for new growing components ... C of tissue and their sum named total non-structural carbohydrates (TNC) in the text 797 2.8 Isotopic analyses and calculations Total C and N concentrations and 1 3C/ 1 2C or 15N/14N isotopic ratios ... decreased carbon assimilation and stomatal conductance but Ci:Ca ratio and predawn water potential remained unaltered This last point led us to hypothesize that the decrease in net CO2 assimilation...
  • 11
  • 399
  • 0