0

c and 13 c labelling of plant cell walls as a means of assessing ligno cellulose degradation

In Vitro Screening of Plant Resources for Extra-Nutritional Attributes in Ruminants: Nuclear and Related Methodologies pptx

In Vitro Screening of Plant Resources for Extra-Nutritional Attributes in Ruminants: Nuclear and Related Methodologies pptx

Sức khỏe giới tính

... state-based and national plant databases and compiled into an Access database These databases principally contained information on plant taxonomic relationship that enabled the identification of the plant ... Identify the search area Assemble a database of species occurring in the search area Review family and genera and remove those that have characteristics not matching the specified plant attributes ... M Hoffmann, Natascha Selje-Assmann, Klaus Becker, R John Wallace, and Glen A Broderick 55 Screening for Compounds Enhancing Fibre Degradation Devki N Kamra, Neeta Agarwal, and Tim A McAllister...
  • 252
  • 4,509
  • 0
ECOLOGY OF COLD SEEP SEDIMENTS: INTERACTIONS OF FAUNA WITH FLOW, CHEMISTRY AND MICROBES potx

ECOLOGY OF COLD SEEP SEDIMENTS: INTERACTIONS OF FAUNA WITH FLOW, CHEMISTRY AND MICROBES potx

Nông nghiệp

... assemblages of characteristic seep megafauna are in some cases associated with distinct infaunal assemblages On Hydrate Ridge, the Beggiatoa, Calyptogena and Acharax macrofaunal communities were ... diverse assemblage of micro-, meio- and macrofauna (Buck & Barry 1998, Bernhard et al 2001, Levin et al 2003, Robinson et al 2004) 13 LISA A LEVIN Epifauna and megafauna Abundance, composition and characteristics ... scarps where bedding planes outcrop and along faults associated with salt tectonics at passive margins Formation and dissociation of gas hydrate outcrops also can drive short-term, small-scale...
  • 46
  • 435
  • 0
INTERACTIONS OF POLYMERS WITH FIBRILLAR STRUCTURE OF CELLULOSE FIBRES: A NEW APPROACH TO BONDING AND STRENGTH IN PAPER docx

INTERACTIONS OF POLYMERS WITH FIBRILLAR STRUCTURE OF CELLULOSE FIBRES: A NEW APPROACH TO BONDING AND STRENGTH IN PAPER docx

Tự động hóa

... anhydroglucose unit CLSM confocal laser scanning microscope CMC carboxymethyl cellulose C- PAM cationic poly(acrylamide) cryo-SEM cryogenic scanning electron microscope CS cationic starch D.S degree of ... PDADMAC induced a sharp increase in frequency and a decrease in dissipation, indicating a reduction of the detected mass and an increase in elasticity of the surface Logically, the frequency ... b) change in dissipation ( D) as a function of time during adsorption of xyloglucan, CMC, and PDADMAC on cellulose nanofibril model surfaces (Paper II) In contrast to xyloglucan and CMC, addition...
  • 89
  • 701
  • 1
Báo cáo khoa học: Surface-enhanced vibrational spectroscopy for probing transient interactions of proteins with biomimetic interfaces: electric field effects on structure, dynamics and function of cytochromec doc

Báo cáo khoa học: Surface-enhanced vibrational spectroscopy for probing transient interactions of proteins with biomimetic interfaces: electric field effects on structure, dynamics and function of cytochromec doc

Báo cáo khoa học

... this sense, SAM-coated electrodes are able to mimic some basic features of biological interfaces as far as Coulombic interactions are concerned Specifically, the interfacial potential distribution ... VA, Jiang J, Tyurina YY, Ritov VB, Amoscato AA, Osipov AN, Belikova NA, Kapralov AA, Kini V et al (2005) Cytochrome c acts as a cardiolipin oxygenase required for release of proapoptotic factors ... molecules even at submonolayer coverages of surfaces [10] A particular advantage of SERR and SEIRA spectroscopy is that the signal-amplifying support material may also be used as a working electrode...
  • 9
  • 437
  • 0
Báo cáo khoa học: Interactions of ultraspiracle with ecdysone receptor in the transduction of ecdysone- and juvenile hormone-signaling pdf

Báo cáo khoa học: Interactions of ultraspiracle with ecdysone receptor in the transduction of ecdysone- and juvenile hormone-signaling pdf

Báo cáo khoa học

... (Stratagene, La Jolla, CA, USA) where the sequence of the mutation-target primer was: 5¢-CGACCAGGTGATTCTGagTGAAAGCCGCTT GGATCG-3¢ Antisense dEcR in pIE1-4 was prepared by cloning its PCR product ... placed at the N-terminus of the dUSP by cloning a double-stranded oligomer of the following sequence (upper strand, 5¢-AGCTACCCATACGACGTGCCAGACTACG CATCTCTG-3¢) into the BamHI site of the above ... were harvested and the activity of the luciferase reporter was measured using a luciferase assay kit (Promega) in a multipurpose scintillation counter (Beckman, Fullerton, CA, USA) b-galactosidase...
  • 13
  • 414
  • 0
Báo cáo y học:

Báo cáo y học: "Complex genetic association of 6q23 with autoimmune rheumatic conditions" docx

Báo cáo khoa học

... References Dieguez-Gonzalez R, Calaza M, Perez-Pampin E, Balsa A, Blanco FJ, Cañete JD, Caliz R, Carreño L, de la Serna AR, FernandezGutierrez B, Ortiz AM, Herrero-Beaumont G, Pablos JL, Narvaez ... full understanding of the biological basis of the genetic associations of this region with autoimmune rheumatic diseases Competing interests The authors declare that they have no competing interests ... Arthritis Research & Therapy Vol 11 No Maxwell et al and inflammatory bowel disease [2] Approximately 20% of pseudogenes are transcribed, and some generate siRNAs that target homologous...
  • 2
  • 206
  • 0
Interactions of viologens with conducting polymers, metal salt solutions and glucose oxidase

Interactions of viologens with conducting polymers, metal salt solutions and glucose oxidase

Cao đẳng - Đại học

... Modification and Characterization 2.3.1 Surface Grafting 2.3.2 Plasma Modification 2.3.2.1 Plasma Treatment 2.3.2.2 Plasma Polymerization 2.3.3 Surface Characterization CHAPTER PHOTO-INDUCED REACTION ... heterolytic and hemolytic cleavage, as well as pericyclic reactions Viologens are one of the few photochromic organic compounds that function by a set of oxidation-reduction reactions (Crano and Guglielmetti, ... viologens to attain the appropriate molecular orbital energy levels can, in principle, allow a color choice of the radical cation In comparison with dications and radical cations, relatively little...
  • 223
  • 609
  • 0
Tài liệu Báo cáo khoa học: Comparison of a coq7 deletion mutant with other respiration-defective mutants in fission yeast doc

Tài liệu Báo cáo khoa học: Comparison of a coq7 deletion mutant with other respiration-defective mutants in fission yeast doc

Báo cáo khoa học

... CAAGCAGGTGAATTAGGC GGGGATCCGTCGACCTGCAGCGTACGAAAATCGTTTACACATC GTTTAAACGAGCTCGAATTCATCGATGCTAGTCCTTTATG CAGGCAAGTCTGTTTATTG CTTGGATGAGCTTTCCAC CGTATAAATTACAATACCG GGGGATCCGTCGACCTGCAGCGTACGACATACTACTTCATTTG ... GGGGATCCGTCGACCTGCAGCGTACGACATACTACTTCATTTG GTTTAAACGAGCTCGAATTCATCGATCCTAGCGTTACCGTTG GTATGCGATGTGGAATTTG GATGCCTTCCAATGAATTAC GAACCAATGAAATAAGGGCG GGGGATCCGTCGACCTGCAGCGTACGAGGAAAGGAAATAGGC GTTTAAACGAGCTCGAATTCATCGATCCGTCAACGACAGTTG ... Spcoq3-m cyc1-w cyc1-x cyc1-y cyc1-z cyc1-m nb2 primer CCGTCGACCAAGCTTATGTTTCCTTATTTTTACAGACG CCCCCGGGGCCACTTTCTGGTG GTACAAGCTTGTAAATTTTCGATGG CATAGAATTCTTGGTAATC AAAGTCGACATGTTGTCACGTAGACAG CAAGCAGGTGAATTAGGC...
  • 16
  • 646
  • 0
Báo cáo khoa học: The capsid protein of human immunodeficiency virus: interactions of HIV-1 capsid with host protein factors ppt

Báo cáo khoa học: The capsid protein of human immunodeficiency virus: interactions of HIV-1 capsid with host protein factors ppt

Báo cáo khoa học

... helix of CA-CTD (C4 , magenta) Adjacent helices of CA (C1 in teal, C2 in orange, and C3 in blue) are also indicated structs localized sites of interaction in Gag and LysRS to residues 308–362 at ... FEBS A P Mascarenhas and K Musier-Forsyth Proteomics of HIV-1 capsid A HIV-1 Gag 364 MA NH2 378 CA 433 NC 133 B Fig HIV-1 Gag domains and CA crystal structure (A) Domain arrangement of Gag Different ... showed that expression of hTRIM 5a in target cells caused a decrease in the amount of particulate N-MLV capsids and a concomitant increase in cytosolic N-MLV CA protein, whereas the expression of rhTRIM5a...
  • 10
  • 398
  • 0
Báo cáo khoa học: Interactions of imidazoline ligands with the active site of purified monoamine oxidase A potx

Báo cáo khoa học: Interactions of imidazoline ligands with the active site of purified monoamine oxidase A potx

Báo cáo khoa học

... derivatives Ann NY Acad Sci 88, 313 331 Raddatz R, Savic SL, Bakthavachalam V, Lesnick J, Jasper JR, McGrath CR, Parini A & Lanier SM (2000) Imidazoline-binding domains on monoamine oxidase B and ... UK), and all other chemicals were obtained from Sigma-Aldrich Co Ltd (Poole, UK) MAO -A assays and spectral titrations Initial rates of oxidation were measured spectrophotometrically at 30 C in ... G, Sastre M, Barturen F, Martin I & Garcı´ a- Sevilla JA (1993) Discrimination and pharmacological characterization of I-2-imidazoline sites with [3H]-idazoxan and alpha-2 adrenoceptors with [3H]Rx821002...
  • 9
  • 473
  • 0
Báo cáo khoa học: Interactions of HIPPI, a molecular partner of Huntingtin interacting protein HIP1, with the specific motif present at the putative promoter sequence of the caspase-1, caspase-8 and caspase-10 genes pdf

Báo cáo khoa học: Interactions of HIPPI, a molecular partner of Huntingtin interacting protein HIP1, with the specific motif present at the putative promoter sequence of the caspase-1, caspase-8 and caspase-10 genes pdf

Báo cáo khoa học

... Allowing two substitutions Allowing two substitutions Allowing one substitution AAAGACATG AAAGACAGG AAAGAGATT AAAGAGATG AAAGACATA AAAGACATA AAAGAGAAC AAAGACATA AAAGAAAAG AAACAGATG AAAGAAAAG AAAGAAAAG ... Result Average Kd (nM) AAAGACATG AGAGACATG AAGGACATG AAATACATG AAAGCCATG AAAGAGATG AAAGACCTG AAAGACACG AAAGACATA + ND ND – – + ND ND ND + – – – – + – + – 0.25 1.5 p=0.01 60_HI 60M_HI Fig The caspase-1 ... (IDT, Coralville, IA, USA) In addition, oligonucleotides, namely AGAGACATG (P2), AAGGACATG (P3), AAATACATG (P4), AAAGCCATG (P5), AA AGAGATG (P6), AAAGACCTG (P7), AAAGACACG 3896 Cloning of the Hippi...
  • 14
  • 393
  • 0
Báo cáo khoa học: Differential interactions of decorin and decorin mutants with type I and type VI collagens pptx

Báo cáo khoa học: Differential interactions of decorin and decorin mutants with type I and type VI collagens pptx

Báo cáo khoa học

... TATGACAATC-3¢ and 5¢-GATTGTCTACAACTGGG CACC-3¢ The amino acid at E180 in DCN E180Q is likewise substituted A cDNA construct for the truncated decorin species DCN Q153 (M1–Q153), in which six of ... Preparation of methylated type I collagen and type VI collagen Type I collagen was isolated from calf skin and methylated by treatment with 0.2 M methanolic HCl for days at ambient temperature as ... (GraphPad Software) CD spectroscopy A Jobin-Yvon CD6-Dichrograph spectropolarimeter (Yvon, France) was used to measure CD spectra at ambient temperature in NaCl/Pi in a 0.1-mm path length quartz...
  • 10
  • 458
  • 0
Báo cáo Y học: Molecular interaction of neutral trehalase with other enzymes of trehalose metabolism in the fission yeast Schizosaccharomyces pombe pdf

Báo cáo Y học: Molecular interaction of neutral trehalase with other enzymes of trehalose metabolism in the fission yeast Schizosaccharomyces pombe pdf

Báo cáo khoa học

... Sigma Chemical Co.] and the ECL system (Amersham-Pharmacia) Enzyme assays and trehalase activation Trehalase activity was assayed after cell breakage as described previously [23] Activation of ... oligonucleotide TPSINT-1 (CCGCTCGAGCCTAACGG TGTGGAATAC, which hybridizes at positions 715–732 in the tps1+ ORF and shows an internal XhoI site), and the 3¢ oligonucleotide TAF-3 (CTACGGCGGCCGCCCGAGC ... were concentrated by trichloroacetic acid precipitation, separated by SDS/PAGE, transferred to nitrocellulose and incubated with anti-Ha Ig After incubation with an HRP-conjugated secondary antibody...
  • 9
  • 428
  • 0
Đề tài

Đề tài " On the periods of motives with complex multiplication and a conjecture of GrossDeligne " pdf

Thạc sĩ - Cao học

... algebraic subvarieties of X; a subvariety of X has a cycle class in the dual of a rational homology space of X and the duals of these cycle classes span a subspace of homology, which might be large ... normalisation, the integral of an algebraic differential against a cycle class will be an algebraic number The celebrated Hodge conjecture describes the space spanned by the classes of the algebraic ... of the conjecture However, even in the case of CM abelian varieties, the conjecture seems far from proof: as far as the authors know, only the case of Dirichlet characters has been tackled up...
  • 29
  • 512
  • 0
Báo cáo khoa học: Interactions of elongation factor EF-P with the Escherichia coli ribosome doc

Báo cáo khoa học: Interactions of elongation factor EF-P with the Escherichia coli ribosome doc

Báo cáo khoa học

... and a 22-nucleotide cDNA primer 5¢-TCTCCAGCGCCACGGCAGATAGG GACC-3¢, complementary to domain V of the 23S rRNA as described in Experimental procedures [20,21,24] A, T, G, C are dideoxy sequencing ... electrospray interface for liquid chromatography-microspray and nanospray mass spectrometry Anal Biochem 263, 93–101 Eng JK, McCormack AL & Yates JRI (1994) An approach to correlate tandem mass-spectral ... Ganoza MC (1980) Identification and quantification of elongation factor EF-P in Escherichia coli cell- free extracts Can J Biochem 58, 131 2 131 4 31 Xu A, Jao DL & Chen KY (2004) Identification of mRNA...
  • 11
  • 362
  • 0
Báo cáo khoa học: Interaction of the C1 complex of Complement with sulfated polysaccharide and DNA probed by single molecule fluorescence microscopy pdf

Báo cáo khoa học: Interaction of the C1 complex of Complement with sulfated polysaccharide and DNA probed by single molecule fluorescence microscopy pdf

Báo cáo khoa học

... 1.4 NA oil objectives (Leica) was used and a cooled CCD camera (C4 880 Hamamatsu, and Ixon-Andor) was mounted on the microscope For fluorescence observations, a mercury lamp was used in combination ... Molecular combing of the T4 DNA on a PMMA surface after incubation with fluorescent C1 complex and fucoidan addition of C1 r* and fucoidan (molar ratio C1 q/fucoidan : 100) The resulting molecular combing ... binding of CLR to DNA The C1 complex, which triggers the classical pathway of Complement, comprises the subunit C1 q and the two serine proteases C1 r and C1 s associated into a C1 r2 C1 s2 tetramer...
  • 7
  • 395
  • 0
Báo cáo khóa học: The proteasome inhibitor, MG132, promotes the reprogramming of translation in C2C12 myoblasts and facilitates the association of hsp25 with the eIF4F complex pptx

Báo cáo khóa học: The proteasome inhibitor, MG132, promotes the reprogramming of translation in C2C12 myoblasts and facilitates the association of hsp25 with the eIF4F complex pptx

Báo cáo khoa học

... survival of our cells under these stressful conditions as they can directly modulate the activity of Akt30 and prevent apoptotic cell death by binding to, and inactivating caspase-3, caspase-9 and ... occurs concomitantly with a moderate increase in binding of 4E-BP1 to eIF4E In contrast, the association of hsp25 (and hsp70; data not shown) with eIF4F increased dramatically at later times of ... localization; hsp25 appeared to be mainly perinuclear while aB-crystallin was more cytoplasmic and granular in appearance These studies are consistent with reports using a related myoblast cell...
  • 16
  • 404
  • 0
Báo cáo khoa học: Characterization of the interactions of the nephrin intracellular domain Evidence that the scaffolding protein IQGAP1 associates with nephrin potx

Báo cáo khoa học: Characterization of the interactions of the nephrin intracellular domain Evidence that the scaffolding protein IQGAP1 associates with nephrin potx

Báo cáo khoa học

... polymerization, cell cell adhesion and cell motility, whereas Cdc42-activation triggers the formation of filopodia and affects cell cell adhesion IQGAP1 accumulates at the polarized leading edge and areas of ... identification of IQGAP1, an effector protein of small GTPases Rac1 and Cdc42 and a putative regulator of cell cell adheren junctions [39,40] According to the GST pull-down assays, the interaction ... Promega, Madison, WI, USA) was done overnight at 30 C Incubation was stopped by acidification with trifluoroacetic acid, and peptides were extracted and concentrated by vacuum 239 Intracellular domain...
  • 16
  • 333
  • 0
Báo cáo Y học: Chimeric receptor analyses of the interactions of the ectodomains of ErbB-1 with epidermal growth factor and of those of ErbB-4 with neuregulin potx

Báo cáo Y học: Chimeric receptor analyses of the interactions of the ectodomains of ErbB-1 with epidermal growth factor and of those of ErbB-4 with neuregulin potx

Báo cáo khoa học

... full-length cDNA molecule encoding ErbB-4 was obtained from human brain Quick-Clone cDNA (Clontech) by the PCR, and was inserted into the AflII–Xba I sites of the mammalian expression plasmid pcDNA3.1/Zeo(+) ... Characterization of the N-oligosaccharides attached to the atypical Asn-X-Cys sequence of recombinant human epidermal growth factor receptor J Biochem 127, 65–72 30 Abe, Y., Odaka, M., Inagaki, F., Lax, I., ... retained on the cells was then measured by a gamma counter (closed bars) For competition assays, the cells were incubated with 125Ilabeled EGF in the presence of a 200-fold excess amount of unlabeled...
  • 7
  • 450
  • 0
Báo cáo khoa học: Interactions of the peripheral subunit-binding domain of the dihydrolipoyl acetyltransferase component in the assembly of the pyruvate dehydrogenase multienzyme complex of Bacillus stearothermophilus pot

Báo cáo khoa học: Interactions of the peripheral subunit-binding domain of the dihydrolipoyl acetyltransferase component in the assembly of the pyruvate dehydrogenase multienzyme complex of Bacillus stearothermophilus pot

Báo cáo khoa học

... 5¢-ATGCCGTCCGTGATGAAGTATGC-3¢; R135M (reverse), 5¢-CGCGCATACTTCATCACGGAC GGCAT-3¢; R135K (forward), 5¢-GCCATGCCGTCCGT GAAGAAGTATGCGCGCGAAAAA-3¢; R135K (reverse), 5¢-TTTCGCGCGCATACTTCTTCACGGACGGCA-3¢; ... CCTCTAGAAA-3¢; 3¢-end primer (reverse), 5¢-GCGGG ATATCCGGATATAGT-3¢; R135L (forward), 5¢-ATG CCGTCCGTGCTCAAGTATGC-3¢; R135L (reverse), 5¢CGCGCATACTTGAGCACGGACGGCAT-3¢; R135M (forward), 5¢-ATGCCGTCCGTGATGAAGTATGC-3¢; ... R13 5C (forward), 5¢-ATGCCGTCCGTGTGCAAGTA TGC-3¢; R13 5C (reverse), 5¢-CGCGCATACTTGCACAC GGACGGCAT-3¢ The altered codons are underlined The mutants were constructed in plasmid pET11ThDD as described...
  • 9
  • 322
  • 0

Xem thêm