c agriculture and a human right to food

Freedom from Want - The Human Right to Adequate Food (Advancing Human Rights series) pptx

Freedom from Want - The Human Right to Adequate Food (Advancing Human Rights series) pptx

Ngày tải lên : 14/03/2014, 21:20
... as food, clean water, and health care, but also rights of protection against abuse, neglect, and exploitation, and the right to education and to participation in social, religious, political, and ... International Covenant on Civil and Political Rights and the International Covenant on Economic, Social, and Cultural Rights There are also two Optional Protocols to the International Covenant on Civil ... Declaration of Human Rights, the International Covenant on Civil and Political Rights, and the International Covenant on Economic, Social, and Cultural Rights apply to all persons The covenants include...
  • 278
  • 795
  • 0
AN1113   using c and a hardware module to interface 8051 MCUs with i2c™ serial EEPROMs

AN1113 using c and a hardware module to interface 8051 MCUs with i2c™ serial EEPROMs

Ngày tải lên : 11/01/2016, 16:45
... certified © 2008 Microchip Technology Inc DS01113B-page 13 WORLDWIDE SALES AND SERVICE AMERICAS ASIA/PACIFIC ASIA/PACIFIC EUROPE Corporate Office 2355 West Chandler Blvd Chandler, AZ 85224-6199 Tel: ... Data (n + 2) P SDA Line Bus Activity © 2008 Microchip Technology Inc A C K A C K A C K A C K N A C K DS01113B-page AN1113 INITIALIZATION START DATA TRANSFER Initialization consists of initializing ... Device Address T S1 010 AAA0 MSB Address Byte S T O P Data Byte S 1 A A A1 A C K A C K Bus Activity S T A Control Byte/ R Device Address T LSB Address Byte A C K P N A C K A C K PAGE WRITE OPERATION...
  • 14
  • 273
  • 0
AN1234   using c and a hardware module to interface texas instruments MSP430XXXX MCUs with SPI serial EEPROMs

AN1234 using c and a hardware module to interface texas instruments MSP430XXXX MCUs with SPI serial EEPROMs

Ngày tải lên : 11/01/2016, 17:02
... DS0123 4A- page 15 WORLDWIDE SALES AND SERVICE AMERICAS ASIA/PACIFIC ASIA/PACIFIC EUROPE Corporate Office 2355 West Chandler Blvd Chandler, AZ 85224-6199 Tel: 480-792-7200 Fax: 480-792-7277 Technical ... REAL ICE, rfLAB, Select Mode, Total Endurance, WiperLock and ZENA are trademarks of Microchip Technology Incorporated in the U.S .A and other countries SQTP is a service mark of Microchip Technology ... on recycled paper Microchip received ISO/TS-16949:2002 certification for its worldwide headquarters, design and wafer fabrication facilities in Chandler and Tempe, Arizona; Gresham, Oregon and...
  • 14
  • 315
  • 0
HACCP AND ISO 22000 APPLICATION TO FOODS OF ANIMAL ORIGIN

HACCP AND ISO 22000 APPLICATION TO FOODS OF ANIMAL ORIGIN

Ngày tải lên : 08/04/2014, 01:22
... endorsing HACCP approach Richmond Report advocated use of HACCP Codex HACCP draft The NACMCF system defined HACCP as a systematic approach to be used in food production as a means to assure food safety’ ... the food trade and facilitates international trade in food The Codex General Principles of Food Hygiene has recommended a HACCP-based approach as a means to enhance food safety and has indicated ... ADI AEA AFB1 AFLP AFM1 AHS ALARA ALOP AMI APC APMV-1 AR ASF ATP AVC BHT BMPs BSE BVD CBI CCPs CFIA cfu CP CPs CPU CSF DDD DDE DDT DEFT DIS DM DSI DSP EAN EBL Acceptable dairy intake Association...
  • 561
  • 416
  • 1
Báo cáo toán học: " An introduction to 2-fuzzy n-normed linear spaces and a new perspective to the Mazur-Ulam problem" docx

Báo cáo toán học: " An introduction to 2-fuzzy n-normed linear spaces and a new perspective to the Mazur-Ulam problem" docx

Ngày tải lên : 20/06/2014, 21:20
... An introduction to 2-fuzzy n-normed linear spaces and a new perspective to the Mazur–Ulam problem Choonkil Park1 and Cihangir Alaca∗2 Department of Mathematics, Research Institute for Natural ... Sciences, Hanyang University, Seoul 133-791, Korea Department of Mathematics, Faculty of Science and Arts, Celal Bayar University, 45140 Manisa, Turkey ∗ Corresponding author: cihangiralaca@yahoo.com.tr ... space onto a real normed linear space is a linear mapping up to translation Baker [12] showed an isometry from a real normed linear space into a strictly convex real normed linear space is a ne...
  • 39
  • 371
  • 0
Đề luyện thi Đại học môn Hóa số 1 (Tổng hợp) pps

Đề luyện thi Đại học môn Hóa số 1 (Tổng hợp) pps

Ngày tải lên : 02/08/2014, 08:21
... HCOONa C CH3CHO, CH3COONa, CH3COOH D CH3CHO, CH3COOH, CH3COONa 27 Trung hoà mol α - aminoaxit X c n mol HCl tạo muối Y c hàm lượng Clo 28,286% khối lượng C ng th c cấu tạo X A H2N-CH2-CH2-COOH ... t a Ag thu A 1,08 gam B 3,24 gam C 1,62 gam D 2,16 gam 26 Cho sơ đồ biến hoá C 2H + H2O xt X + O2 xt Y + NaOH Z + NaOH CaO,t CH4 C ng th c chất X,Y,Z A CH2=CHOH, CH3CHO, CH3COONa B HCHO, HCOOH, ... dung dịch sau phản ứng thu 10,2 gam muối khan C ng th c phân tử A là: A C2 H5COOH B C2 H5COOCH3 C HCOOC3H7 D C3 H7COOH 43 C ống nghiệm đựng dung dịch muối clorua gồm: CuCl 2, MgCl2, FeCl3, AlCl3 Nếu...
  • 9
  • 360
  • 2
A novel role of hydrogen sulfide in wound healing and a new approach to wound dressing in rat model

A novel role of hydrogen sulfide in wound healing and a new approach to wound dressing in rat model

Ngày tải lên : 26/09/2015, 09:39
... standards and samples were assayed in duplicate The H2S concentration of each sample was calculated according to a standard curve of NaHS (3.125−250 µM) and the enzyme activity was expressed as ... significantly accelerated the wound healing compared to control animals -6- Abbreviations: PAG: DL-propargylglycine BCA: β-cyano-L-alanine Ac-Na: Diclofenac Sodium Ac-S: S-diclofenac CSE: Cystathionine-γ-lyase ... Clinically, both local and systematic factors can affect the healing process These include tissue hypoxia, denervation, hematoma, infection, irradiation and mechanical forces Wound dressing can...
  • 80
  • 424
  • 0
A facile construction of the tricyclic 5 7 6 scaffold of fungi derived diterpenoids  the  rst total synthesisof (±) heptemerone g and a new approach to danishefsky s intermediate for a guanacastepene

A facile construction of the tricyclic 5 7 6 scaffold of fungi derived diterpenoids the rst total synthesisof (±) heptemerone g and a new approach to danishefsky s intermediate for a guanacastepene

Ngày tải lên : 26/01/2016, 09:27
... in acetone and treated with a catalytic amount of p-toluenesulfonic acid Compound was obtained (crystalline solid, 95% yield) showing the expected HRMS spectrum and 1H, and 13 C NMR spectra (500 ... (d) Ac2O, DMAP, Et3N, CH2Cl2, rt; 94%; (e) acetone, PPTS (cat.), rt, 94%; (f) acetone, p-TSA, rt, 95% Ketone 18 was reduced applying the Luche protocol,20 and the resulting alcohol was protected ... Ac d) Scheme Transformations of the core carbocyclic systems Reagents and conditions: (a) LiAlH4, THF, À93 C, chromatography, 77%; (b) LiAlH4, THF, rt, 0.5 h; (c) PhI(OAc)2, TEMPO, CH2Cl2, rt,...
  • 3
  • 547
  • 0
Tài liệu Making the Right Moves A Practical Guide to Scientifıc Management for Postdocs and New Faculty doc

Tài liệu Making the Right Moves A Practical Guide to Scientifıc Management for Postdocs and New Faculty doc

Ngày tải lên : 21/02/2014, 12:20
... understandings in place that allow the faculty to appropriately carry out activities, from teaching to research to the provision of clinical care Key academic health center officials include the ... individual typically runs an active research lab BWF HHMI 27 Making the Right Moves A Practical Guide to Scientific Management Department chair: Each college is likely to have several departments, and ... career as an academic researcher But as you establish your own laboratory and build your research program, you are becoming aware that research skills are only part—albeit a critical part—of what you...
  • 267
  • 616
  • 0
Báo cáo khoa học: Platination of telomeric sequences and nuclease hypersensitive elements of human c-myc and PDGF-A promoters and their ability to form G-quadruplexes Viktor Viglasky potx

Báo cáo khoa học: Platination of telomeric sequences and nuclease hypersensitive elements of human c-myc and PDGF-A promoters and their ability to form G-quadruplexes Viktor Viglasky potx

Ngày tải lên : 23/03/2014, 06:20
... approximately 263 nm and a negative band at approximately 240 nm, whereas antiparallel G4 structures, such as basket and chair forms, show two positive bands at approximately 295 and 240 nm and ... anti-cancer therapy, using speci c small molecules that are able to stabilize DNA quadruplexes [6,13] Platinum complexes, which are widely used for cancer therapies, have a high affinity to attack ... of action Proc Natl Acad Sci USA 104, 17347–17352 15 DeCian A & Mergny JL (2007) Quadruplex ligands may act as molecular chaperones for tetramolecular quadruplex formation Nucleic Acids Res 35,...
  • 9
  • 324
  • 0
Tài liệu Importing the Law in Post-Communist Transitions The Hungarian Constitutional Court and the Right to Human Dignity pptx

Tài liệu Importing the Law in Post-Communist Transitions The Hungarian Constitutional Court and the Right to Human Dignity pptx

Ngày tải lên : 18/02/2014, 11:20
... importation was not a mechanical or a passive response to Western exportation and chapter endeavours to unravel and to explain this complex and unique process which was one of the major characteristics ... efforts and resources to throw out ‘bad’ communist dictators in order to replace them with democratically elected leaders After the first and most spectacular changes, the realisation began to dawn ... ideology and its law, an understanding of these was a useful step towards elucidating key constitutional changes Literature on communist law was (comparatively) more easily available and in particular...
  • 238
  • 490
  • 0
Tài liệu A Science Roadmap for Food and Agriculture pdf

Tài liệu A Science Roadmap for Food and Agriculture pdf

Ngày tải lên : 22/02/2014, 05:20
... profitable and efficient animal management practices, to formulate new approaches to improve human health and fight disease, and to improve the interfaces between animal agriculture and landscapes (natural, ... Food and Agriculture p  19  Grand Challenge 20  p A Science Roadmap for Food and Agriculture Grand Challenge We must adapt to and mitigate the impacts of climate change on food, feed, fiber, and ... programs that lead to agricultural technologies, practices, and policies for increasing resilience and adaptive capacity Such capacity will not only lessen the impacts of climate change on agriculture...
  • 104
  • 415
  • 0
Báo cáo khoa học: A kinetic approach to the dependence of dissimilatory metal reduction by Shewanella oneidensis MR-1 on the outer membrane cytochromes c OmcA and OmcB potx

Báo cáo khoa học: A kinetic approach to the dependence of dissimilatory metal reduction by Shewanella oneidensis MR-1 on the outer membrane cytochromes c OmcA and OmcB potx

Ngày tải lên : 07/03/2014, 09:20
... CTGCTGCTCGCAGCAAGT GTGTGATCTGCAACTGTT CACCGAGGAATAATAAATGATG AAACGGTTCAATTTC TTAGTTACCGTGTGCTTC CACCGAGGAATAATAAATGATG AACGCACAAAAATCA TTACATTTTCACTTTAGT OMCA-PBAD-R OMCB-PBAD-F OMCB-PBAD-R 3736 controlled ... OMCA-KO-R OMCB-KO-F OMCB-KO-R OMCA-F OMCA-R OMCB-F OMCB-R OMCA-PBAD-F CACACTGCAACCTCTGGT ACTGTCAATAGTGAAGGT CCCCATGTCGCCTTTAGT TCGCTAGAACACATTGAC ATGATGAAACGGTTCAAT TTAGTTACCGTGTGCTTC CTGCTGCTCGCAGCAAGT ... recognized that both cytochromes, OmcA and OmcB, appear to have some substrate specificity, as purified reduced batches lack activity towards nitrite, nitrate and, in the case of OmcA, uranyl acetate...
  • 11
  • 731
  • 0
Báo cáo khóa học: Disruption of the interaction between the Rieske iron–sulfur protein and cytochrome b in the yeast bc1 complex owing to a human disease-associated mutation within cytochrome b potx

Báo cáo khóa học: Disruption of the interaction between the Rieske iron–sulfur protein and cytochrome b in the yeast bc1 complex owing to a human disease-associated mutation within cytochrome b potx

Ngày tải lên : 07/03/2014, 15:20
... domain movement in cytochrome bc1 and its implication for energy conversion Proc Natl Acad Sci USA 97, 4567–4572 Saribas, A. S., Valkova-Valchanova, M., Tokito, M.K., Zhang, Z., Berry, E .A & Daldal, ... QH2-cytochrome c reductase activity The assays were performed as described in the Experimental procedures QH2-cytochrome c reductase activity was measured spectrophotometrically, at room temperature, ... reduction kinetics The reduction kinetics of cytochrome b and cytochromes c and c1 were monitored using a dual-wavelength Aminco DW 2A spectrophotometer equipped with a rapidly stirred reaction cuvette,...
  • 7
  • 498
  • 0
Báo cáo khoa học: Biochemical properties of the human guanylate binding protein 5 and a tumor-specific truncated splice variant Mark Wehner and Christian Herrmann doc

Báo cáo khoa học: Biochemical properties of the human guanylate binding protein 5 and a tumor-specific truncated splice variant Mark Wehner and Christian Herrmann doc

Ngày tải lên : 15/03/2014, 10:20
... reflecting larger structural changes accompanying nucleotide binding The rate constants for nucleotide association and dissociation are both much smaller for hGBP5 compared to hGBP1, reflecting a ... hGBP1 and other large GTPases, we analysed the enzymatic activity of hGBP 5a ⁄ b and hGBP5ta in a concentration-dependent manner Various concentrations of purified hGBP 5a ⁄ b and hGBP5ta were incubated ... (MÆcm))1), and their purity was checked by HPLC analysis (> 98% for all used nucleotides) Data analysis was performed using an ITC-Origin calorimeter (Microcal ⁄ GE Healthcare) Size-exclusion chromatography...
  • 9
  • 462
  • 0
Báo cáo khoa học: Nucleosome positioning in relation to nucleosome spacing and DNA sequence-specific binding of a protein doc

Báo cáo khoa học: Nucleosome positioning in relation to nucleosome spacing and DNA sequence-specific binding of a protein doc

Ngày tải lên : 16/03/2014, 10:20
... pU6lac2 was derived from pU6lac3 such that L1 was deleted to give two lac operator sites, and the vector DNA Bluescript, pBKS+ (Stratagene, La Jolla, CA, USA) was used in place of the plasmid ... mM salt (R3 was added to lanes 13–16) The primer was located 64 bp upstream of lac operator L2, hybridizing to the bottom strand as shown schematically in the right- hand bottom corner GATC shows ... Escherichia coli lac operon An unidentified conformational change was reported to accompany the binding of the lac repressor to nucleosomal DNA [32] Similar to this, we have observed an asymmetric...
  • 15
  • 299
  • 0
Báo cáo khoa học: "Paragraph-, word-, and coherence-based approaches to sentence ranking: A comparison of algorithm and human performance" ppt

Báo cáo khoa học: "Paragraph-, word-, and coherence-based approaches to sentence ranking: A comparison of algorithm and human performance" ppt

Ngày tải lên : 17/03/2014, 06:20
... statistical natural language processing Cambridge, MA, USA: MIT Press Daniel Marcu 2000 The theory and practice of discourse parsing and summarization Cambridge, MA: MIT Press Mandar Mitra, Amit ... not account for that difference and would rate Algorithm A as “hit” but Algorithm B as well as Algorithm C as “miss” In order to collect performance measures that are more adequate to the evaluation ... paragraph as important, and the other sentences as not important We included this approach merely as a simple baseline 2.2 Word-based approaches Word-based approaches to summarization are based...
  • 8
  • 415
  • 0
Báo cáo Y học: Incorporation of 3-nitrotyrosine into the C-terminus of a-tubulin is reversible and not detrimental to dividing cells potx

Báo cáo Y học: Incorporation of 3-nitrotyrosine into the C-terminus of a-tubulin is reversible and not detrimental to dividing cells potx

Ngày tải lên : 17/03/2014, 10:20
... Educacion en el marco del Programa de Modernizacion Tecnologica (BID 802/OC-AR), Consejo Nacional de Investigaciones Cientı´ ficas y ´ ´ Tecnicas (CONICET), Secretarı´ a de Ciencia y Tecnica de ... 15 ACKNOWLEDGEMENTS 16 We thank Drs Carlos E Argarana and Mario Guido for critical ˜ reading of the manuscript, Mrs S N Deza and Mrs M G Schachner for technical assistance and Dr Stephen Anderson ... de la Univer´ ´ sidad Nacional de Cordoba y Agencia Cordoba Ciencia del Gobierno ´ de la Provincia de Cordoba, Argentina 17 REFERENCES 20 Barra, H.S., Arce, C. A. , Rodrı´ guez, J .A & Caputto,...
  • 9
  • 518
  • 0
Aaron r  bradley   programming for engineers  a foundational approach to learning c and matlab

Aaron r bradley programming for engineers a foundational approach to learning c and matlab

Ngày tải lên : 19/03/2014, 14:05
... throughout the chapter The name “stack” is purposely descriptive: think of a stack of plates in a cafeteria One can push data (plates) onto the stack and pop data (plates) off the stack In both cases, ... arrays is crucial for writing anything but the simplest of programs Rather than taking an abstract and rule-based perspective, this chapter covers the program stack and the function call protocol, ... transferring command-line arguments (see Chapter 5) to main and main’s return value back to the operating system We are finally ready to treat program memory as the stack that we have been calling it...
  • 250
  • 655
  • 0