c 324 334 mother of john chrysostom the father of the eastern church
C++ Lab 15 Review of Arrays, Array of Objects and Vector Dr. John Abraham, Professor doc
... the data, the second one to find the difference of each score from the mean and the third one to find store the square of deviation of each score The mean is calculated by adding all valid scores ... place random numbers from to 52 in it Once we have the random numbers, we just display the card names in that order string cards[52]={ "CA", "C2 ", "C3 ", "C4 ", "C5 ", "C6 ", "C7 ", "C8 ", "C9 ", "C1 0","CJ","CQ","CK", ... Read scores from a file into an array Keep track of number of scores entered Find difference of each score from the Mean Square the differences and add the squares find stadard deviation create...
- 7
- 416
- 1
Báo cáo khoa học: Detection and characterization of a novel extracellular fungal enzyme that catalyzes the specific and hydrolytic cleavage of lignin guaiacylglycerol b-aryl ether linkages pdf
... suggested that production of the b-aryl ether cleavage enzyme might be induced under speci c conditions Analysis of the products of the reaction revealed the presence of guaiacylglycerol (GG) and ... shown) Localization of enzymatic activity To confirm the localization of the b-aryl ether cleavage activity, we prepared a hyphae fraction (HP), an extracellular fraction (EC), a cytoplasmic fraction ... al (Eur J Biochem 270) Fig Mass spectra of guaiacylglycerol and guaiacol, products of the b-aryl ether cleavage reaction The reaction products of GOG generated by the b-aryl ether cleavage enzyme...
- 10
- 670
- 0
Báo cáo khoa học: Bovine tryptases cDNA cloning, tissue specific expression and characterization of the lung isoform ppt
... CAGTACGTCCCCCAGGGGCCCtgagcctggtccccaggccgccccctgggtcagcggaggagctggccccca 864 ♦ cagtcccctcaacactgcttccggccgaggaggagaccttcccccaccttccccggccccctgtcccagtgc 936 ccacacctgatgaccccactcctggctgtacccctctcccgctcagctcacccccccgcaggggctgctgac ... CAGTACGTCCCCCAGGGGCCCtgagcctggtccccaggccgccccctggtcagcggaggagctggccccctc 864 Q Y V P Q G P ♦ (245) tgtcccctcagcgctgcttccggcccgaggaggagaccttcccccaccttccctggccccctgcccaatgcc 936 cacccctggctgacccctctctgctgacccctccctgccctgaacccctgccccagccccctccccactagc 1008 tcagggcgctggcaggggctgctgacactcataaaaagcatggagagcag ... 288 CTGCTGCCCATCAGCAGGATCATCCCCCACCCCAACTGCTACAGCGTTAAGAACGGGGCGGACATCGCCCTG 360 CTGGAGCTGGACAAGCTTGTGAATATCTCCTGGCACGTCCAGCCGGTCACCCTGCCCCCTGAGTCGGAGACC 432 TTCCCCCCGGGGACGCAGTGCTGGGTGACGGGCTGGGGCAACGTGGACAATGGAAGGCGCCTGCCGCCCCCA...
- 11
- 527
- 0
Báo cáo khoa học: Peroxin Pex21p interacts with the C-terminal noncatalytic domain of yeast seryl-tRNA synthetase and forms a specific ternary complex with tRNASer potx
... SC, S cerevisiae; SP, Schizosaccharomyces pombe Only eukaryotic cytosolic enzymes contain positively charged C- terminal extensions The C- terminal sequence of S cerevisiae and Z mays cytosolic ... designed ScSerRSDC20 lacked the 20 C- terminal amino acids, whereas in ScSerRSDC13, only the fragment of 13 amino acids (containing seven lysines) was cut off Truncated yeast SerRS constructs were ... addition of Pex21p When the ionic strength was reduced to 30 mm NaCl and the concentration of Mg2+ was increased (8 mm MgCl2), the stability of the binary complex was increased (Fig 2B) Pex21p increases...
- 12
- 406
- 0
Báo cáo khoa học: Identification of a copper-repressible C-type heme protein of Methylococcus capsulatus (Bath) A member of a novel group of the bacterial di-heme cytochrome c peroxidase family of proteins docx
... R GGCAACGAGCAAGGTCCGAAG AAGTCGTTGCAATCGGCGTCG GGCAACGAGCAAGGTCCGAAG GACGTCGTGAGTGCCTCCGTG CGACGTGCAGTATTACTTTTCTAGGG AGTATCAAACCGTGCTGGTCTCC Bioinformatic analyses Sequence similarity searches ... by RT-PCR analyses (Fig 7C) Detection of C- type heme Because of the sequence similarity of SACCP to members of the BCCP family of proteins and the prediction of heme-binding motifs in the primary ... located to the cellular surface of the methanotrophic bacterium M capsulatus This protein shares characteristics with the members of the BCCP family, but separates itself from the described CCPs...
- 12
- 392
- 0
Báo cáo khoa học: Elements of the C-terminal t peptide of acetylcholinesterase that determine amphiphilicity, homomeric and heteromeric associations, secretion and degradation docx
... effects on the level of cellular activity, and decreased secretion to 50% of the wild type The three mutants produced mostly amphiphilic T2a dimers in the cell extracts; in the case of M21D, the ... amphiphilic, those formed in the presence of a cysteine at position 21 were nonamphiphilic, indicating that, in this case, the hydrophobic patches occluded each other because of the formation of a ... segment The fact that deletion of residue 12, near the N-terminal end of the aromatic cluster, had no such effect, indicates that the orientation of the aromatic cluster relative to the catalytic domain...
- 12
- 309
- 0
Differences by Mother''''s Education in the Effect of Childcare on Child Obesity pdf
... differences in the education level of the mother and the childcare provider: in this case, the higher education levels of caregivers especially in center care relative to that of children whose mothers ... employment and childcare experience affect the current work and childcare choices of mothers As expected, the results show that the high work experience increases the likelihood in working in the current ... on the coefficients for the interaction of both the
- 52
- 504
- 0
Báo cáo khoa học: Expression and characterization of soluble forms of the extracellular domains of the b, c and e subunits of the human muscle acetylcholine receptor pot
... ATTCCGGAACCAGGAGGAGCGC-3¢ was used in all cases, together with the reverse primer (a) 5¢-ATA GTTTAGCGGCCGCTTACTTGCGCTGGATGATGAG CAGG-3¢ for c1 –218, (b) 5¢-ATAGTTTAGCGGCCGC TTAGTGATGGTGATGGTGATGCTTGCGCTGGATG ... the forward primer 5¢-GGTGTAGAATTCAAGAACGAGGAACTGCG-3¢ was combined with (a) 5¢-ATAGTTTAGCGGCCG CTTACTTCCGGCGGATGATGAGCGAG-3¢ for e1–219, (b) 5¢-ATAGTTTAGCGGCCGCTTAGTGATGGTGATG GTGATGCTTCCGGCGGATGATGAGCGAG-3¢ ... GTGATGCTTCCGGCGGATGATGAGCGAG-3¢ for e1– 219HIS, (c) 5¢-ATAGTTTAGCGGCCGCTTACGGCTT CCGGCGGATGATGAGCGAG-3¢ for e1–220, or (d) 5¢ATAGTTTAGCGGCCGCTTAGTGATGGTGATGGTGA TGCGGCTTCCGGCG-GATGATGAGCGAG-3¢ for e1–...
- 12
- 394
- 0
Báo cáo khóa học: The C-terminal t peptide of acetylcholinesterase forms an a helix that supports homomeric and heteromeric interactions potx
... Prediction of secondary structure elements The secondary structure of the C- terminal region of the catalytic domain and of the t peptide was predicted according to Rost [27] using PREDICTPROTEIN ... of the t peptide: in the side view, the distance of each residue from the helix axis corresponds to the vertical dimension, with the central residue of the aromatic cluster (W17) at the top The ... of 30–40 and then increased again (not shown) Such biphasic curves were previously observed for lipid–peptide interactions occurring in the concentration range of the critical micellar concentration...
- 15
- 333
- 0
Báo cáo khoa học: The soluble form of the membrane-bound transferrin homologue, melanotransferrin, inefficiently donates iron to cells via nonspecific internalization and degradation of the protein pdf
... relevance to the clearance of sMTf from the circulation in conditions such as melanoma and Alzheimer’s disease [19,20] and the possible use of this molecule as a carrier for chemotherapeutic agents ... suggests increased efficacy of conjugates compared to free agents [49,50] It is possible that the use of the conjugate may enable the delivery of the agent to the lysosomal compartment that then results ... SK-N-MC neuroepithelioma cells, MRC-5 fibroblasts and MCF-7 breast cancer cells, were obtained from the American Type Culture Collection Mouse LMTK– fibroblasts were obtained from the European Collection...
- 11
- 373
- 0
Báo cáo sinh học: " Regulation of FeLV-945 by c-Myb binding and CBP recruitment to the LTR" doc
... synthetic oligonucleotides -/+ (5'-GCTGAAACAGCAGAAGTTTCAAGGCCACTGCCAGCAGATTCAAGGCCACTGCCAGCAGTTTCAAGGCCACTGCCAGCAGTCTCCAGGCTCCCCAGTTGAC-3') and +/- (5'-GCTGAAACAGCAGAAGTTTCAAGGCCACTGCCAGCAGTTTCAAGGCCACTGCCAGCAGATTCAAGGCCACTGCCAGCAGTCTCCAGGCTCCCCAGTTGAC-3') ... the synthetic oligonucleotide GS945 as template (5'GCTGAAACAGCAGAAGTTTCAAGGCCACTGCCAGCAG TTTCAAGGCCACTGCCAGCAGTTTCAAGGCCACTGCCAGCAGTCTCCAGGCTCCCCAGTTGAC -3'), the filling primer (5'-CTGGTCAACTGGGGAGCCT-3') ... using the oligonucleotide GS61E as template (5'-GCTGAAACAGCAGAAGTTTCAAGGCCACTGCCAGCAGTCTCCAGG CTCCCCAGTTGAC-3') Nuclear extract from K-562 cells was obtained from Active Motif (Carlsbad, CA) Nuclear...
- 10
- 410
- 0
United States General Accounting Office Washington, D.C. 20548 Comptroller General of the United States _part1 docx
... Treasury; the Chairman of the Board of Governors of the Federal Reserve System; the Acting Comptroller of the Currency; and the Chairmen and Ranking Minority Members of the Senate Committee on ... Insurance Corporation; the Director of the Page GAOIAFMD-92-73 This is trial version www.adultpdf.com Bank Inrurance Fund h B.114881 Office of Management and Budget; the Secretary of the Treasury; the ... S our consideration of FDIC’ internal control structure and on its compliance with laws and regulations as they relate to the Fund We conducted our audits in accordance with generally accepted...
- 11
- 272
- 0
United States General Accounting Office Washington, D.C. 20548 Comptroller General of the United States _part2 pot
... financial reporting, consisting of the policies and procedures related to the form, content, and preparation of the Fund’ financial statements s For each of the internal control structure categories ... number of additional concerns The Inspector General’ audit, which was also s conducted at four FDIC consolidated receivership offices, found that high error rates in LAMIS files compromised the accuracy ... transactions are executed in accordance with management’ s authorization and recorded properly to permit the preparation of financial statements in accordance with generally accepted accounting...
- 11
- 276
- 0
United States General Accounting Office Washington, D.C. 20548 Comptroller General of the United States _part3 potx
... uncertaintiesbecause of changing economic condltlons affecting real estate assets now In the marketplace These factors could reduce the BIF’ actual recovarlas upon the sale of these assets from the level of recoveries ... amortized cost, which is the purchase price of securities less the amortized premium or plus the accreted discount Such amortlzatlone and accretlons are computed on a daily basls from the date of acquisltlon ... settlement on the sale to Citicorp of the Delaware Brfdge Sank (the credft card subsidlary of Flrst RepublIcBankof Texas) Those funds were released In July of 1991 Cash and cash equivalentsas of December31...
- 11
- 304
- 0
United States General Accounting Office Washington, D.C. 20548 Comptroller General of the United States _part4 doc
... pooi, the FDIC pays the assuming bank the aggregate of net losses over net geinr lf any In eddltlon to the rbcwe coete for which the receiver has a claim against the assets of the receIvership ,the ... asset putbacks the tctal volume d a88ets for which the FDIC remains at risk and the estimated cost of these tmnaactkwrs,whkh Include8 credit losaea carrylng cost8 and admlnlstmtlve and lncentlve ... The FDIC relied on this flndlng regarding aofvencyaa the determlnlngfactor In deflnlng the existence of the “accountable event’that triggers loaa recognition under generally accepted accounting...
- 11
- 303
- 0
United States General Accounting Office Washington, D.C. 20548 Comptroller General of the United States_part1 potx
... Acting Chairman of the Board of Directors of the Federal Deposit Insurance Corporation; the Chairman of the Board of Governors of the Federal Reserve System; the Comptroller of the Currency; the Acting ... permit the preparation of financial statements in accordance with generally accepted accounting principles, and (3) transactions of BIF, SAIF, and FRF were executed in accordance with significant ... and the results of its operations and its cash flows for the years then ended, in conformity with generally accepted accounting principles The financial statements and accompanying notes of the...
- 13
- 273
- 0
United States General Accounting Office Washington, D.C. 20548 Comptroller General of the United States_part2 potx
... procedures for processing and reconciling cash receipts at its consolidated receivership offices Because FDIC is in the process of merging certain consolidated receivership offices as part of ... recovery rates contained in FDIc’ Credit Manual s ‘“A4justed pool balance represents the principal balance of the asset, net of specific reserves, as reflected on the accounting records of the relevant ... strategies, certain FDIC and servicers’ account officers applied across -the- board discounts to appraised values in estimating recoveries, while other account officers estimated recoveries at 100 percent...
- 13
- 266
- 0
United States General Accounting Office Washington, D.C. 20548 Comptroller General of the United States_part3 pot
... FDIC’S oversight personneI to verify the accuracy of the activity and balances on these systems; and require the servicer to reconcile checks received to checks deposited each day, and reconcile ... document the accuracy and completeness of the balances and activity reported to FLHC contracted asset servicers back to the servicers’ detail by records This is trial version www.adultpdf.com Page ... of the Federal Deposit Insurance Corporation direct the heads of the Division of Depositor and Asset Services and the Division of Finance to + promptly reconcile servicer asset bahrnces each...
- 13
- 239
- 0
United States General Accounting Office Washington, D.C. 20548 Comptroller General of the United States_part4 doc
... remain subject to uncertainties because of changing economic conditions These factors could reduce the claimants’ actual recoveries upon the sale of these assetsfrom the level of recoveries currently ... and certain qualifying expenses These arrangements typic-ally direct that the receiver pay to the acquirer a specified percentage of the losses triggered by the charge-off of assets covered by the ... with any of its estimated losses, the FDIC cannot predict the timing of events with reasonable accuracy These liabilities and a corresponding reduction in the Fund Balance are recognized in the period...
- 13
- 342
- 0
United States General Accounting Office Washington, D.C. 20548 Comptroller General of the United States_part5 pdf
... future cash tlows because the FDlC cannot predict the timing of events with reasonable accuracy For this reason, the FDIC considers the total estimate of these losses to be the best measure of their ... 12,153 2c! u& 282,382 $282,382 (1) Consists of one-day special Treasury Certificates For 1992, the accumulated liability is presented in the Statementsof Financial Position - “Accounts payable, accrued ... significantly increase the cost of bank resolutions to the FDIC Further, comparisons with other financial instruments not provide a reliable measure of their fair value Due to these and other factors,...
- 13
- 282
- 0
Tìm thêm: xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến mômen quay m fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose