byblock autocad draws new objects in the default color white or black depending on your configuration until they are grouped into a block when the block is inserted in the drawing the objects in the block inherit the current setti
autocad 2004 2d training manual
... commands and system variables, including those that open, close, or save a window or a drawing, display information, change the graphics display, regenerate the drawing, or export the drawing in ... the options for creating a new drawing Click The OK button Save the drawing as another name TIP: New drawings can also be created from Template Files - 20 - AutoCAD 2D Tutorial 2.3 Saving Drawings ... Drawings SAVE and SAVEAS Saves the most recent changes to a drawing The first time an unnamed drawing is saved the “Save As” dialog box appears AutoCAD saves its drawings as files with extensions...
- 358
- 733
- 0
Tài liệu Performing a SQL SELECT Statement and Storing the Rows Locally phần 1 docx
... (database administrator) will provide you with the appropriate values for the connection string The DBA is responsible for administering the database The following example creates a string named ... name For example: server=localhost The name of the database You set this in the database part of the string For example: database=Northwind The name of the user to connect to the database as You ... this in the uid part of the string For example: uid=sa The password for the database user You set this in the pwd part of the string For example: pwd=sa Note Typically, your organization's DBA...
- 4
- 348
- 0
Tài liệu Performing a SQL SELECT Statement and Storing the Rows Locally phần 2 docx
... containing the DataRow objects stored in that DataTable You can use the Rows property in a foreach loop to iterate over the DataRow objects For example: foreach (DataRow myDataRow in myDataTable.Rows) ... Display the columns for each row in the DataTable, using a DataRow object to access each row in the DataTable The DataTable class defines a property named Rows that returns a DataRowCollection ... myDataTable = myDataSet.Tables["Customers"]; // step 13: display the columns for each row in the DataTable, // using a DataRow object to access each row in the DataTable foreach (DataRow myDataRow...
- 5
- 349
- 0
Báo cáo khoa học: Enzymatic oxidation of NADP+ to its 4-oxo derivative is a side-reaction displayed only by the adrenodoxin reductase type of ferredoxin-NADP+ reductases potx
... excluded the possibility that this was a consequence of enzyme denaturation by assaying the enzyme during incubation A reasonable explanation is that NADPO was acting as a competitive inhibitor of the ... of Glu214 and His57 of FprA in the catalysis of NADPO production As it was not possible to obtain detailed information on the catalytic mechanism of the NADP+ oxidation reaction by kinetic studies, ... data [4], that the mechanism of NADPO formation can be split in two half-reactions: the first leads to NADPO formation coupled to FAD reduction; and the second consists of the reoxidation of FADH2...
- 10
- 406
- 0
A Fast File System for UNIX
... written into the available space 2) The file contains no fragmented blocks (and the last block in the file contains insufficient space to hold the new data) If space exists in a block already allocated, ... allocated, the space is filled with new data If the remainder of the new data contains more than a full block of data, a full block is allocated and the * A program may be overwriting data in the middle ... The remaining new data is written into the located space 3) The file contains one or more fragments (and the fragments contain insufficient space to hold the new data) If the size of the new data...
- 14
- 1,023
- 0
Domestic Wastewater Reclamation Coupled with Biofuel/Biomass Production Based on Microalgae: A Novel Wastewater Treatment Process in the Future
... microalgal cultivation The CO2 gas could be the waste gas from the power plant or some other places, so this is also an approach of CO2 fixation In the microalgal cultivation system the microalgae ... filtration CO2 Wetland plants Microalgae cultivation and reclamation Wastewater Artificial wetland Disinfection Primary settled sludge Microalgal cells Organics in high concentration Oil extraction ... process are indentified and listed below Flocculation of organic pollutants by organic flocculants Inorganic flocculants, such as aluminum and ferric salts, are popular at present However, these inorganic...
- 9
- 762
- 0
Evaluating Variables in a Flat File
... perform the replacements in each case is fairly simple It consists of one small loop that looks at each line in the flat file and replaces any variables with their assigned values You can easily ... USERID, and REMAINING) and their escape sequences When the script executes, the account expiration date for each possible USERID is checked, and the script determines how many days REMAINING there are ... command in the final element of the command pipeline The specific e-mail command is up to you; a couple of common ones are mailx and mail, depending on your operating system This technique has many...
- 2
- 272
- 0
A discussion proposal on people''''s adaptability to floods in the Mekong river delta
... out the general rules of the seasonal flows, forecast the relation between the warm atmosphere and the storms in the tropical monsoon Asia Survey and forecast the effects of the dams and irrigation ... of their production, even in high flooding if they are not so unusual Many years before, they did not say the word “flood season” but used “raising water season” In fact, floods bring new organic ... works such as pumping stations, irrigation and drainage canal systems, crop protection dikes and dams have been built in the Mekong Delta Almost these water works were investigated by the national...
- 2
- 481
- 0
Performing a Bulk Insert with SQL Server
... private const String DATAFILENAME = ConfigurationSettings.AppSettings["Project_Directory"] + @"Chapter 09\Customers.xml"; private const String SCHEMAFILENAME = ConfigurationSettings.AppSettings["Project_Directory"] ... defines an optional error log file, where the default is an empty string meaning that no error log is created You can bulk load data into multiple parent-child tables at the same time, a feature ... Load component is used through COM interop to bulk insert data contained in a XML document into a SQL Server database This component controls the execution of a XML bulk load operation The example...
- 5
- 395
- 0
Viewing a WSDL File and Testing a Web Service
... with a DataTable containing the one row from the Customers table with a CustomerID of ALFKI, as shown in Figure 17.5 Notice that the equals (=) and single quote (') characters in the whereClause ... with a DataTable containing all the rows from the Customers table (see Figure 17.6) Notice that the space characters in the whereClause parameter value have been converted to plus (+) characters ... at another example; enter the following string as your whereClause and click the Invoke button: CustomerID IS NOT NULL This causes the RetrieveCustomers() method to return a DataSet with a DataTable...
- 7
- 382
- 0
Tài liệu Module 7: Performing a Basic MMS Implementation pdf
... Northwind Traders Connector Connector Namespace Namespace Automatic Join HR Database HR Database Connector Connector Namespace Namespace Lead -in To address the business requirements of Northwind ... database to a format that is acceptable in the co attribute in Exchange and the co attribute in Active Directory The value of the c attribute in the Human Resources database represents the ISO ... convert the c attribute in the Create an advanced attribute flow script to convert the c attribute in the attribute HR database to a format that is acceptable in the co attribute in n HR database...
- 12
- 426
- 0
Tài liệu Connecting to a Text File pptx
... OleDbDataAdapter da = new OleDbDataAdapter("SELECT * FROM [Categories.txt]", ConfigurationSettings.AppSettings["TextFile_0119_ConnectString"]); // Create and fill the table DataTable dt = new DataTable("Categories"); ... from and insert records into a text file data source The Jet database engine can access other database file formats through Indexed Sequential Access Method (ISAM) drivers specified in the Extended ... schema.ini file in the same directory as the text file As an example, a possible schema.ini file for the Categories.txt file used in this solution is: [Categories.txt] Format=CSVDelimited ColNameHeader=True...
- 4
- 348
- 0
Tài liệu Writing a Script File in Linux pptx
... Creating the Script Login as a Root and make sure that to be in the home directory StudentA5 will be used as an example in this lab Ask the instructor for the correct login for the computer At the ... that are used with the tar command: -c Create a new archive -t List the contents of an archive -x Extract the contents -f Write the archive to file -M Span multiple floppies if the archive is ... tar –tvf mywpdocs.tar (the –t will list all the files) To extract all the files, use the following command: tar –xvf mywpdocs.tar (the –x extracts the contents) The following is a list of flags...
- 4
- 442
- 1
Tài liệu Lab A: Performing a Basic MMS Implementation docx
... domain.nwtraders.msft • Username: Domain\Administrator • Password: password Password: password • Forest to discover: domain.nwtraders.msft • Username: Domain\Administrator • • Mode: Association ... Perform the join Complete the join by using MMS Account Joiner to manually join any remaining disconnectors a Complete the join by using MMS Account Joiner to manually join any remaining disconnectors ... Performing a Basic MMS Implementation Exercise Creating and Operating the NWTRADERS Management Agent In this exercise, you will create and operate the NWTRADERS management agent Scenario A management...
- 20
- 393
- 0
Tài liệu PSEUDO-SECRETS: A Freedom of Information Audit of the U.S. Government’s Policies on Sensitive Unclassified Information doc
... CAI/EPA (“originator or information manager”) CBI/EPA (“originator or information manager”) ECI/EPA (“originator or information manager”) FOUO/DHS (“An y DHS employee, detailee, or contractor”) ... UCNI/DOE (“Reviewing Official”) CAI/EPA (“originator or information manager”) CBI/EPA (“originator or information manager”) ECI/EPA (“originator or information manager”) SBU/State (“US citizen ... Supervisor haphazard manner NASA’s Administratively Controlled Information (ACI) policy, for example, states that the “[o]fficial who originally designated material as ACI (or successor or superior)...
- 54
- 463
- 0
Tài liệu Báo cáo khóa học: Trichostatin A reduces hormone-induced transcription of the MMTV promoter and has pleiotropic effects on its chromatin structure pptx
... chromatin incorporating them To see whether the increased transcription leakage observed at early addition of TSA can be explained by an accumulation of acetylated forms of histones in a time-dependent ... that early TSA addition increases the acetylation status of bulk histones as well as the histones organizing the minichromosomes Structural alterations in nucleosomal organization caused by TSA treatment ... cleavage of DNA by alkali [31] The method allows easy detection of DNA–protein interactions via the N7 position of guanines in the major groove and via the N3 position of adenines in the minor...
- 10
- 500
- 0
Tài liệu Panache: A Parallel File System Cache for Global File Access ppt
... micro-benchmark [4] to measure the overhead Panache incurs to queue and flush metadata operations on the gateway nodes Finally, we run a parallel visualization application and a Hadoop application to analyze ... write the remote data to the shared storage, which the application nodes can then read and return the data to the application Another option is for gateway nodes to transfer the data directly to the ... cluster Panache scales on both cache miss and cache hit On cache miss, Panache incurs the overhead of passing data through the SAN, while on a cache hit it saturates the SAN among the other gateway...
- 14
- 635
- 0
COMBINING EVIDENCE ON AIR POLLUTION AND DAILY MORTALITY FROM THE 20 LARGEST US CITIES: A HIERARCHICAL MODELLING STRATEGY potx
... lag structure and prior distributions Description of the databases The analysis database included mortality, weather and air pollution data for the 20 largest metropolitan areas in the USA for ... to average across monitors, after correction for yearly averages for each monitor This yearly correction is appropriate since long-term trends in mortality are also adjusted in the log-linear ... by the amount of data for any location Consequently, in a comparison with analyses of data from a single site, pooled analyses can be more informative about whether an association exists, controlling...
- 40
- 526
- 0
Báo cáo khoa học: Structure of the complex of a yeast glucoamylase with acarbose reveals the presence of a raw starch binding site on the catalytic domain doc
... GLU R1 5A forward (5¢-ATTCAAACTATAAAGTTGACGCAA CTGACTTGGAAACCTTC-3¢), GLU R1 5A reverse (5¢GAAGGTTTCCAAGTCAGTTGCGTCAACTTTATAGTT TGAAT-3¢); GLU H44 7A forward (5¢- GCAAGTCATTT TGGATGCTATTAATGATGATGGCTC-3¢), ... H44 7A reverse (5¢- GAGCCATCATCATTAATAGCATCCAAAA TGACTTGC-3¢); GLU T46 2A forward (5¢- GAACAACTT AACAGATATGCCGGTTATTCCACCGGTGCC-3¢), GLU T46 2A reverse (5¢- GGCACCGGTGGAATAACCGGCA TATCTGTTAAGTTGTTC-3¢); ... that of the catalytic domain of A awamori and T thermosaccharolyticum glucoamylases, with the active site at the narrower end of barrel There is no terminal starch-binding domain, and this is...
- 11
- 548
- 0
Hollywood on the Head of a Pin: Montage and Marketing at the Oscars® docx
... Malden) And since these magical beings are watching and clapping along with a (newly) global “us” in the virtual audience, all the more reason the montage must mean something But despite appearances, ... denominator of the transitions throughout the montage is the fact that they place the individual clips within a discourse of accumulation As images accumulate, our recognition of the movies they are ... era, incorporated a structural refusal of causality or narrative in favor of sheer additivity (omitting avant-garde cinema, the exception that proves the rule) But television’s informational barrage...
- 10
- 612
- 0
Tìm thêm: xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25