branch is embossed on all the locker keys with a view to facilitate authorities in identifying the ownership of the locker keys
Designing a supplementary reading syllabus with a view to improving reading skills for the first-year English majors at Hai Phong Private University
... Vietnam National University viii Part A: Introduction Rationale There is no denying that English is becoming a dominant language over the past few years, especially in the context of globalization ... objectives of the supplementary reading syllabus Based on the main objectives of the syllabus, the advantages and disadvantages of each syllabus type, the background of the target learners as well as the ... no acknowledgement to factors which are needed in the creation of any course Finally, the language-centered analysis of target situation data is often at the surface level, taking little account...
- 83
- 992
- 1
Báo cáo Y học: The Emery–Dreifuss muscular dystrophy associated-protein emerin is phosphorylated on serine 49 by protein kinase A pptx
... protein isoforms (LAP1 and 2) contain a region of homology called the LAP-Emerin-MAN1 (LEM) domain; (residues 2–45 in human emerin) This domain is PKA phosphorylates emerin involved in binding to ... partly, through its interaction with lamin A ⁄ C The nucleoplasmic domain of emerin and the equivalent domains of two other inner nuclear membrane proteins termed MAN1 and the lamina-associated ... peak at 23 625 Da is nonphosphorylated and each subsequent peak increases by an increment of 80 Da corresponding with the molecular mass of an additional phosphate group The y axis is an arbitrary...
- 14
- 418
- 0
báo cáo hóa học:" The prosurvival activity of ascites against TRAIL is associated with a shorter disease-free interval in patients with ovarian cancer" docx
... cancer is a highly metastatic disease characterized by widespread intraperitoneal dissemination of tumor cells and ascites formation The intraperitoneal dissemination of ovarian tumor cells involves ... 1:1223-1232 Abdollahi T, Robertson NM, Abdollahi A, Litwack G: Identification of interleukin as an inhibitor of tumor necrosis factor-related apoptosisinducing ligand-induced apoptosis in the ovarian carcinoma ... including migration, survival in peritoneal fluids, invasion and proliferation Our data show that the prosurvival activity of ascites against TRAIL is associated with a shorter disease-free interval...
- 10
- 383
- 0
Báo cáo khoa hoc:"Effect of the slow (K) or rapid (k +) feathering gene on body and feather growth and fatness according to ambient temperature in a Leghorn × brown egg type cross" ppsx
... especially concerning remiges and rectrices At one day of age, the primary and secondary feathers are like coverts in a slow feathering chick, and at eight days they not have tails Owing to the considerable ... considerable power of thermal insulation of the plumage, this phenomenon may favour heat dissipation towards the environment and thus have an in uence on traits of economic importance: food intake, ... weeks of age Plumage weight was calculated as an absolute value and per cent of body weight, as for males in individual cages 2.4 Statistical analysis Analysis of variance with unequal subclass...
- 12
- 344
- 0
Báo cáo sinh học: "Probability statements about the transmitting ability of progeny-tested sires for an all-or-none trait with an application to twinning in cattle" pptx
... asymptotically normal Following a classical theorem in asymptotic theory (see for instance, formula 6a. 23, page 386 in Rao, 1973) and knowing that: is also one has, given Assuming to a i a as in section ... appealing for practitioners This is especially clear as far as ETA’s are concerned and one may alternatively to tt consider as a sire evaluation, the expectation of !r = !(!) with , * respect to the ... the distribution in (4b) can be viewed as a function of n, 7r and A that is, conditional on n, !6 and the , ? , b distribution of is: r = with expectation and variance Probability statements about...
- 18
- 313
- 0
Closing the Cancer Divide: A blueprint to expAnd Access in low And middle income countries pdf
... •• •• Marian Affarah Marcella Alsan Ala Alwan Ana Mar a Amaris Islene Araujo de Carvalho Martha del Socorro Arias Novoa Larry Bagley Emily Bahnsen Anna Barker Matthew Basilico Janine Barnaby John ... Ministry of Health of Mexico Ministry of Health of Rwanda Ministry of Health of the State of Jalisco Ministry of Heath of the State of Morelos Ministry of Health of the State of Nuevo León National ... Government of Rwanda and Partners in Health This is a concrete example of how collaboration and international partnerships are at the core of achieving any success against cancer Cancer, a disease plagued...
- 286
- 453
- 0
Furniture 2010 A Guide to Sources Available in the Business Information Centre ppt
... right information about their activities and performance is essential to making good business decisions The Information Centre has a wide range of company databases that can provide financials, ... specialises in providing up to date, authoritative financial analysis They publish in- depth industry reports and market analysis on over 1500 UK industries The following is a sample of the reports ... analysis and forecasting based on primary quantitative and qualitative research, providing the full picture on a particular industry, issue or trend The following is a sample of the reports available...
- 12
- 506
- 0
handbook of biochemical kinetics a guide to dynamic processes in the molecular life sciences
... BPTI Bovine pancreatic trypsin inhibitor 10 10 Biochemical Abbreviations A Adenine Alanine or alanyl aa Amino acid aaRS Aminoacyl-tRNA ACAT Acyl-CoA:cholesterol acyltransferase ACES N-(2-Acetamido)-2aminoethanesulfonic ... elongation is occurring Indeed, if Atotal is the total monomer concentration at the beginning of elongation, then the rate of spontaneous nucleation will be proportional to the third power of Atotal ... moderate concentrations of mineral acids The value and sign of ⌽ is a measure of the response of the acid-base equilibria to changes in acid concentration An analogous equation for kinetic data is log...
- 811
- 431
- 0
báo cáo sinh học:" A strategy to improve skills in pharmaceutical supply management in East Africa: the regional technical " potx
... Sciences Other participating institutions in Tanzania include the MOH, the National AIDS Control Program (NACP) and the Tanzania Food and Drug Administration (TFDA) In Rwanda, the RTRC is based at the ... countries Other countries, including Ghana, Liberia and Namibia, have since adapted these materials for local use Training on HIV/AIDS pharmaceutical management In Uganda and Tanzania the RTRC has been ... Collaboration for Pharmaceutical Management concept The Regional Technical Resource Collaboration for Pharmaceutical Management concept Regional coordination and technical assistance Regionally,...
- 6
- 366
- 0
Báo cáo sinh học: " Panicovirus accumulation is governed by two membrane-associated proteins with a newly identified conserved motif that contributes to pathogenicity" pptx
... plants inoculated with the replicating mutants that had variable symptoms (Y33 0A, C33 5A, D36 3A, and P39 9A) All four of the mutations were stably maintained For example the alanine residue is maintained ... this region are indicated on the left and the virus abbreviations are defined in the Methods The amino acids are given in single-letter code Alanine-scanning mutagenesis was targeted to ten amino ... CACACCCTGTAGAGGGCTCTCCAG CCTTTCTTATCAGCCACCCTGTAGAG GGAATACAGCTGGCAAGGC TGATCCTGGGCGTATGCGC GCCCCAACTAATGCATTGGTCACTAG CCAAGCAGTCGCATTGGCCCC a The altered nucleotides on the PMV cDNA are underlined...
- 12
- 307
- 0
báo cáo hóa học:" Research Article Efficient Processing of a Rainfall Simulation Watershed on an FPGA-Based Architecture with Fast Access to Neighbourhood Pixels" pptx
... simulation The speed of the architecture is increased by utilizing a multiple memory bank approach to allow parallel access to the neighbourhood pixel values This approach has the advantage of allowing ... Spartan-3 FPGA Section summarizes this paper The Watershed Algorithm Based on Rainfall Simulation The watershed transformation is based on visualizing an image in three dimensions: two spatial ... image has regions where the pixels have the same value and are not a regional minimum, they are called nonminima plateaus The nonminima plateaus are a group of pixels which can be divided into...
- 19
- 306
- 0
Báo cáo hóa học: "Research Article On Series-Like Iterative Equation with a General Boundary Restriction" docx
... spaces,” Journal of Mathematical Analysis and Applications, vol 299, no 2, pp 651–662, 2004 24 X Wang and J G Si, “Differentiable solutions of an iterative functional equation,” Aequationes Mathematicae, ... Kulczycki and Tabor 22 investigated iterative functional equations in the ˙ class of Lipschitz functions In 2004, Tabor and Zołdak 23 studied the iterative equations in Banach spaces In the above ... problem of differentiable solutions of iterative equations has also fascinated many scholars’ attentions In Zhang 16 and Si 19 , the C1 and C2 solutions of 1.1 are considered In Wang and Si 24 , the...
- 14
- 267
- 0
Báo cáo hóa học: "Approaching the MIMO Capacity with a Low-Rate Feedback Channel in V-BLAST" docx
... MIMO capacity Optimal power allocation with PARC Equal power allocation with PARC Suboptimal power allocation with PARC Equal power & rate allocation (MMSE V-BLAST) MIMO capacity Optimal power allocation ... the average capacity is calculated assuming that a scalar capacity-achieving code is used: Γ = at (1) First, the effect of rate quantization is investigated; later, power quantization is also considered ... combination, the following cases are depicted: MIMO capacity, optimal power allocation with PARC, equal power allocation with PARC, suboptimal power allocation with PARC, and equal power and equal rate allocation...
- 10
- 221
- 0
Báo cáo khoa hoc:" The chicken as a model to study microchromosomes in birds: a review" potx
... during meiosis allows a mixing of the genetic material The recombination index (RI) calculated (RI n + TC, where n is the number of bivalents and TC the total number of chiasmatas) is 90-100 in birds, ... to disappear completely in mammals [68] According to Rodionov [68], it might be tempting to consider them as ancestral chromosomes although they are very rare in fish and batracians Indeed, they ... Myakoshina Y.U., Chelysheva L .A. , Solovei LV., Gaginskaya E.P., Chiasmata on lampbrush chromosomes of Gallus gallus domesticus Cytogenetic investigations of recombination frequency and linkage group...
- 11
- 318
- 0
báo cáo khoa học: "Prediction of genetic merit from data on binary and quantitative variates with an application to calving difficulty, birth weight and pelvic opening" pot
... method is non-linear and approximates the best predictor in a squared error Theoretical objections arising in analysis of categorical data with linear models , IANOLA (e.g., G 1982) are eliminated ... Similarly where p! ! is the fraction of the residual variance of the underlying variable explained a linear relationship with e and e Since the unit of measurement in the conditional , ; ;2 distribution ... was adapted to the situation where the probability of « response» is a function of continuous « riskvariables Also, consideration is given to the assumption that candidates for selection are sampled...
- 23
- 325
- 0
báo cáo khoa học: "A patient presenting with a perivascular epithelioid cell tumor in the broad ligament: a case report" pdf
... pain did not respond to the radiotherapy and has remained the main issue At 10 months after her initial presentation, an examination under anesthesia (EUA) and cystoscopy was performed Operative ... PEComa is made on the basis of histological and immunohistochemical findings Basic characteristic features of perivascular epithelioid cells include abundant clear to eosinophilic granular cytoplasm ... production At a Page of cellular level, it inhibits the activation of the mammalian target of rapamycin (mTOR), a key regulatory kinase, leading to suppression of cytokine-driven T cell proliferation and...
- 6
- 436
- 0
Báo cáo y học: " Axillary silicone lymphadenopathy presenting with a lump and altered sensation in the breast: a case report" pot
... connective tissue and autoimmune diseases and human adjuvant disease [4, 8, 9] At present, the mechanism of such complications is uncertain and in some cases, proof of such a relationship remains ... continued leakage through an intact surface [1,3,4,6,8] The risk of rupture and/or leakage increases with increasing age of the implant, the site of implantation (retroglandular as opposed to ... favourable The rationale for this is that silicone granulomata have been found as incidental findings in axillary nodes removed at mastectomy for breast cancer in the presence of intact breast prostheses...
- 5
- 264
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25