box either type criteria directly in the box or select a cell that contains the value you wish to count
Báo cáo y học: " Safety and efficacy of undenatured type II collagen in the treatment of osteoarthritis of the knee: a clinical trial"
... taking pain medication other than the study medication (for arthritis or other types of pain) or is unwilling to stop taking other medications for the treatment of OA Any other condition that, ... History of cancer as well as gastrointestinal, renal, hepatic, cardiovascular, hematological, or neurological disorders High alcohol intake (>2 standard drinks per day) Pregnant, breastfeeding or ... continue these therapies as normal avoiding changes in frequency or intensity and to record therapies in the study diary Subject agrees not to start any new therapies for OA during the course of the...
- 10
- 706
- 0
báo cáo hóa học: " Type D personality in the general population: a systematic review of health status, mechanisms of disease, and work-related problems" docx
... risk was similar to that of traditional cardiovascular risk factors [7] Some studies that are included in this review explored the behavioral and biological mechanisms of disease as a Mols and ... interventions that are aimed towards improving their coping skills in order to decrease the acute and chronic stress that they experience and thus to decrease their work-related problems and increase their ... the selected articles was assessed with an 11-item standardised checklist of predefined criteria by both investigators The available evidence suggests that Type D is a vulnerability factor that...
- 10
- 595
- 0
Báo cáo hóa học: " Research Article A Hilbert-Type Integral Inequality in the Whole Plane with the Homogeneous Kernel of Degree −2 Dongmei Xin and Bicheng Yang" pdf
... parameters,” Advances in Mathematics, vol 38, no 3, pp 257–268, 2009 B C Yang, “On the norm of an integral operator and applications,” Journal of Mathematical Analysis and Applications, vol 321, ... 2 Journal of Inequalities and Applications All of the above inequalities are built in the quarter plane Yang 10 built a new Hilbert -type integral inequality in the whole plane as follows: ... contradicts the fact that K < k λ Hence the constant factor k λ in 3.1 is the best possible If the constant factor in 3.2 is not the best possible, then by 3.3 , we may get a contradiction that the...
- 11
- 386
- 0
Báo cáo y học: " Solitary Peutz-Jeghers type hamartomatous polyps in the duodenum are not always associated with a low risk of cancer: two case reports" pptx
... was a hamartomatous polyp with a focus of well-differentiated adenocarcinoma, and Case was a hamartomatous polyp with Table Twenty-seven cases of solitary duodenal Peutz-Jeghers type hamartomatous ... MT and HI analyzed endoscopic data YS, HT, TK, CT, YA, AN and SM performed the histological examination of the organs YS, MI and SK were major contributors in writing the manuscript All authors ... Peutz-Jeghers type hamartomatous polyps and PJS may need to be reexamined Our two cases were diagnosed in patients with an advanced age similar to previous reports, but they differ in the malignant alteration...
- 4
- 458
- 0
Báo cáo y học: "Midregional pro-Adrenomedullin in addition to b-type natriuretic peptides in the risk stratification of patients with acute dyspnea: an observational study" ppt
... on the underlying cause Adding to this complexity is the fact that acute dyspnea is often multifactorial and due to cardiac, pulmonary, and inflammatory causes Specific markers for heart and /or ... adjudicator was asked to review the data and determine which diagnosis was the most accurate The endpoint of the present study was defined as one-year allcause mortality Each patient was contacted ... data, analysis and interpretation of data, drafting of the manuscript, critical revision of the manuscript for important intellectual content, had full access to all of the data in the study and...
- 11
- 321
- 0
Type of sport in the world
... Please take note following videos First video for the name of sport Second video for the checking your mind Describe some sports Archery, Athletics, badminton, basketball, beach volleyball, Boxing, ... Boxing, Canoe Slalom, Canoe Sprint, Cycling BMX, Mountain Bike, Cycling Road, Cycling Diving, Equestrian, Fencing, Football, Gymnastics Artistic, Gymnastics - Rhythmic, Handball, hockey, Judo, Morden ... Pentathlon, Rowing, Sailing Shooting, swimming, Synchronised swimming, table tennis, Taekwondo, Tennis, Trampoline, Triathlon, Volley Ball, Water Polo, Weight lifting, Wrestling Can you record name...
- 11
- 321
- 0
Tài liệu Improving health, connecting people: the role of ICTs in the health sector of developing countries ppt
... can be entered into a mobile phone and sent to a central database By creating an up to date database of health information, health workers can track infectious diseases in remote areas, coordinate ... evidence that the majority of health professionals in the developing world are any better informed than they were 10 years ago Lack of access to information remains a major barrier to knowledge-based ... combine an entertaining story with accurate and updated technical information, as the format used involved radio dramas Another approach that can be used to reach out to those not usually included is...
- 65
- 657
- 0
Tài liệu “Don’t spit in the well - you may need to drink from it!” -- Unknown, Russia. docx
... evidence to suggest that these chemicals may be partially responsible for an increase in cancer and birth www.safewater.org defects For more information about PPCPs and other emerging contaminants, ... several best management practices that can reduce the amount of agricultural water pollution, such as collecting animal wastes in a lagoon, or spraying pesticides in small amounts and at minimal ... million and 226.8 million kilograms of phosphates are added into waterways each year The Safe Drinking Water Foundation has educational programs that can supplement the information found in this fact...
- 6
- 467
- 0
Tài liệu In the know - Using information to make better decisions: a discussion paper docx
... question the quality of the analysis and make more informed decisions; and c) analysing data and presenting information to add value, instead of the majority of effort being spent on gathering data and ... paper For example, organisations may invest in large-scale IT solutions to gather and store data and information, or use spreadsheets for smaller sets of information IT and information management ... the statutory targets on educational attainment and early years) alongside locally determined priorities 48 By definition, performance indicators only indicate performance and no one indicator...
- 52
- 360
- 0
Tài liệu Supporting Children Learning English as a Second Language in the Early Years (birth to six years) docx
... second language? The importance of language for young children Partnerships with parents The importance of maintaining the first or home language Why is it important to be bilingual? Maintaining the ... gathering and analysing information about what the learner can do, what they understand and the progress they are making at any particular point in their development Documentation and evaluation can ... provides additional information on the stages in the ESL Companion For further information refer to English as a Second Language (ESL) Companion to the Victorian Essential Learning Standards (VCAA 2005)...
- 31
- 1,043
- 2
The Decline of Traditonal Honor in the West, Ancient Greece to the Romantic Period
... fueled these two factors While it may be tempting to read these posts as saying that these cultural forces are bad, and that personal honor is bad, my goal is rather to simply delineate as objectively ... of honor, you maintain your honor For this reason, Renaissance writers and thinkers began to question this aspect of honor and advocate for sincerity as the true ideal Shakespeare was a harsh ... Rather, Aristotle made a tentative argument that honor be based on attaining personal virtue Excellence meant fulfilling your potential Instead of being loyal to a group’s code of honor, it was...
- 10
- 451
- 0
Arctic smoke – record high air pollution levels in the European Arctic due to agricultural fires in Eastern Europe in spring 2006 pot
... a secondary standard O3 analyzer maintained by the NOAA Earth System Research Laboratory, Global Monitoring Division This secondary standard is calibrated against a standard reference O3 photometer ... J Campbell and E J Welton, for their efforts in establishing ˚ and maintaining the site at Ny Alesund The NASA Micro-Pulse Lidar Network is funded by the NASA Earth Observing System and Radiation ... supported by IGAC, iLEAPS, SPARC, and AMAP We thank A V Dzhola and E I Grechko for providing the total column CO data from Zvenigorod, and L Yurganov for pointing us towards these data We acknowledge...
- 24
- 448
- 0
Báo cáo khoa học: Acylation of lysophosphatidylcholine plays a key role in the response of monocytes to lipopolysaccharide ppt
... suggests that the signaling pathway from the IFN-c receptor to the acyltransferase involves tyrosine kinases but not protein kinase C Such a finding is not unexpected as the Janus family of cytoplasmic ... Monocyte acyltransferase in inflammation (Eur J Biochem 270) 2783 receptor/CD3 complex leads to increased incorporation of polyunsaturated fatty acids into phosphatidylcholine, also mediated by a LPCAT ... duplicate isolated and incubated in the same way as the experiments with MonoMac cells (Fig 3) In addition to TNF -a, the in ammatory cytokine IL-6 was also measured to check that the results were not...
- 7
- 322
- 0
báo cáo sinh học:" Where do students in the health professions want to work?" pptx
... other reasons for wanting to work in a rural area, including professional support, coastal location, happiness, owning a farm, loving the bush and wanting to live there, financial incentives and ... wanting to work in each region of New South Wales Proportion of students wanting to work in each region of New South Wales placement as a factor that would encourage them to work in a rural area, ... implemented the survey and undertook the analysis All authors read and approved the final manuscript 19 20 Acknowledgements The authors wish to acknowledge Rupendra Shrestha for statistical advice and analysis...
- 8
- 393
- 0
Báo cáo sinh học: " A critical assessment for the value of markers to gate-out undesired events in HLA-peptide multimer staining protocols" pot
... data generated and provided by individual laboratories In addition, to minimize the impact of individual laboratory gating, analysis, and interpretation strategies, a censored analysis was also ... available upon request Data Analysis and Interpretation Data generated by individual laboratories were evaluated in ways Initial analysis was performed in a non-censored manner using the numerical ... the central laboratory ("completely out of range”) Data acquisition Individual laboratories acquired the data on their flowcytometer and analyzed the FCS files following laboratory-specific analysis...
- 13
- 752
- 0
báo cáo hóa học: " Strain-dependent variation in the early transcriptional response to CNS injury using a cortical explant system" doc
... Forward CAGACAACATAAACTGCGCCTT Reverse GATACACCTCTCCACCAATGACC IL- 1a Forward TACTCGTCGGGAGGAGACGACTCT 107 bp NM_010554.4 interleukin alpha Reverse TCCTTCAGCAACACGGGCTGGT IL-1b Forward CCTTCCAGGATGAGGACATGA ... respectively Interestingly, the abundance of IL- 1a and COX-2 mRNA revealed a similar pattern to the chemokines suggesting these inflammatory mediators could have a common regulatory mechanism that is ... tumor necrosis factor alpha Reverse AAGTGCATCATCGTTGTTCATACA IL-12 P35 Forward GCATGCTGGTGGCCATCGATGA Reverse GCGTGAAGCAGGATGCAGAGCT IL-12/23 P40 Forward TGTGCTCGTGGCCTGATCCACT Reverse CGCAGCCCTGATTGAAGAGCTGT...
- 8
- 447
- 0
báo cáo hóa học: " Work-related musculoskeletal disorders in the automotive industry due to repetitive work implications for rehabilitation" docx
... test and was asked to participate in an extended orthopedic-chiropractic examination of the cervical vertebrae and upper limbs (table 2) The participation rate for the functional examination was ... of the participants worked at computer monitors for more than hours per day Information about the presenting symptoms and the patient’s respective working environment were obtained during a standardized ... Institutions Workers from two automotive manufacturing plants in Germany participated in this study Plant A assembled gearboxes and small service parts for two German car manufacturers, plant B manufactured...
- 6
- 437
- 0
o cáo hóa học:" A critical assessment for the value of markers to gate-out undesired events in HLA-peptide multimer staining protocols" pot
... data generated and provided by individual laboratories In addition, to minimize the impact of individual laboratory gating, analysis, and interpretation strategies, a censored analysis was also ... available upon request Data Analysis and Interpretation Data generated by individual laboratories were evaluated in ways Initial analysis was performed in a non-censored manner using the numerical ... the central laboratory ("completely out of range”) Data acquisition Individual laboratories acquired the data on their flowcytometer and analyzed the FCS files following laboratory-specific analysis...
- 13
- 579
- 0
báo cáo hóa học:" Current status of medication adherence and infant follow up in the prevention of mother to child HIV transmission programme in Addis Ababa: a cohort study" potx
... collection and reviewing the manuscript KMM was involved in developing the study proposal and reviewing the manuscript All authors have read and approved the final manuscript Competing interests The authors ... conducted in Addis Ababa to assess: 1) adherence to medication regimen among mothers and infants in a PMTCT programme; 2) the proportion of infants followed up in the PMTCT programmes; and 3) the rate ... Analyzing medication initiated by the mothers during pregnancy, we used abortion and death of a mother as study endpoints Analyzing medication ingested by mother-infant pairs at birth, we used abortion,...
- 10
- 712
- 0
- click in the criteria box either type criteria directly in the box or select a cell that contains the value you wish to check the range against
- click in the average range text box and select the range you wish to average
- click in the criteria range1 box select a range of cells that contains the values you wish to check the criteria against
- click in the criteria range1 box select the range of cells that you wish to count
- in the by changing cell box enter the reference for the cell that contains the value you want to adjust in the example this is cell b3
- click within the data to be sorted in the column you wish to sort by
- box type each unique entry in the order you want to sort the entries separate the entries by pressing enter
- you should see that your data list is selected completely if not due to empty columns or rows delete the values in the list range box and either type in the range you wish or select the correct range with the mouse
- click in reference text box select one of the sheets you wish to consolidate and select the data on that sheet the range will appear in the reference box you will notice it is absolute
- click on drop down arrow to the right of object in select the sheet you wish to move it to
- design tab which becomes available when you select a cell that contains a sparkline you can use the sparkline colour or marker colour commands to choose a colour for the high low first and last values such as green for high and orange for low
- click on a cell that contains a sparkline type in the title you wish for it
- select the text or placeholder text of the shape you wish to remove in the text pane
- type in the text you wish to appear in the text box
- select the slide you wish to return to the default content layout for that slide type
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25