benefits of a leadership role
Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf
Ngày tải lên :
15/02/2014, 01:20
... demonstrated that Asp129 of NirF
could not be essential for any function similar to that
in Asp141 of Met8P.
The idea of NirF being a dehydrogenase is appealing
because of the presence of a putative ... understood. Anal-
ysis of insertional mutagenesis and complementation
work in Pseudomonas aeruginosa, Pseudomonas fluores-
cens, Paracoccus denitrificans and Pseudomonas stutzeri
have shown that a set of ... 23 Chang CK (1994) Heme d
1
and other heme cofactors
from bacteria. Ciba Found Symp 180, 228–238.
24 Van Spanning RJ, Wancell CW, De Boer T, Hazelaar
MJ, Anazawa H, Harms N, Oltmann LF &...
- 12
- 613
- 0
Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx
Ngày tải lên :
18/02/2014, 11:20
... mutations
Mousumi Banerjee
1
, Hemalatha Balaram
2
and Padmanabhan Balaram
1
1 Molecular Biophysics Unit, Indian Institute of Science, Bangalore, India
2 Molecular Biology and Genetics Unit, Jawaharlal ... Ravindra G & Balaram P (2005) Plasmodium
falciparum triosephosphate isomerase: new insights into
an old enzyme. Pure Appl Chem 77, 281–289.
20 Parthasarathy S, Ravindra G, Balaram H, Balaram ... in
enzymes: a study of triosephosphate isomerase and
comparison with methyl glyoxalsynthase. Adv Protein
Chem 66, 315–372.
45 Gunasekaran K, Ramakrishnan C & Balaram P (1996)
Disallowed Ramachandran...
- 15
- 635
- 0
Tài liệu Báo cáo khoa học: The role in the substrate specificity and catalysis of residues forming the substrate aglycone-binding site of a b-glycosidase docx
Ngày tải lên :
18/02/2014, 17:20
... 5Â-gagagattt
gctttgcgggttatggatctgc-3Â; mutation K20 1A, 5Â-gttatggatctgct
accgcggctccgatcctaaacg-3Â; mutation K201F, 5Â-ggttatggatctg
ctacttcgctccgatcctaaacgc-3Â; and mutation M45 3A, 5Â-ggacaa
ctttgaatgggcggagggttatattgag-3Â. The ... sense strand are listed, as follows: mutation E19 0A,
5Â-caacgagcctagagcgatttgctttgagg-3Â; mutation E190Q, 5Â-caa
cgagcctagacagatttgctttgagg-3Â; mutation E19 4A, 5Â-gagagattt
gctttgcgggttatggatctgc-3Â; ... Isorna P, Polaina J, Latorre-Garcı
´
a L, Can
˜
ada FJ,
Gonza
´
lez B & Sanz-Aparı
´
cio J (2007) Crystal structure
of Paenibacillus polymyxa b-glucosidase B complexes
reveal the molecular basis...
- 12
- 731
- 0
Tài liệu Báo cáo khoa học: The most C-terminal tri-glycine segment within the polyglycine stretch of the pea Toc75 transit peptide plays a critical role for targeting the protein to the chloroplast outer envelope membrane ppt
Ngày tải lên :
19/02/2014, 07:20
... study.
Name Sequence (residues 91–100)
WT GGGAGGGGGG
polyAla *SA*AAAAA*
AGG AAA*******
GAG ****AAA***
GGA *******AAA
GAA ****AAAAAA
AGA AAA****AAA
AAG AAA*AAA***
GGD *******DDD
GGE *******EEE
GGL *******LLL
GGN ... tion apparatus, faces the stromal compartment. J Biol
Chem 273, 16583–16588.
21 Gunasekaran K, Nagarajaram HA, Ramakrishnan C &
Balaram P (1998) Stereochemical punctuation marks in
protein ... or glutamic acid also caused missorting of Toc75 to the stroma. By
contrast, its replacement with repeats of asparagine, aspartic acid, serine,
and proline did not largely affect correct targeting....
- 9
- 496
- 0
Tài liệu Báo cáo khoa học: The role of the ESSS protein in the assembly of a functional and stable mammalian mitochondrial complex I (NADH-ubiquinone oxidoreductase) pptx
Ngày tải lên :
19/02/2014, 16:20
... antibodies
were as follows: anti-porin from Calbiochem, anti-HA from
Covance BabCo, anti-mouse and anti-rabbit secondary
antibodies from Bio-Rad Laboratories and Amersham
Pharmacia Biotech, respectively. Antibodies ... fraction is designated as the
mitochondrial fraction.
Immunochemical assays and antibodies
Mitochondrial protein samples (between 50 and 100 lg)
were separated by SDS/PAGE and BN/PAGE and trans-
ferred ... s uspension was
used per assay. Oxygen consumption was measured polaro-
graphically with a Clark oxyge n electrode in metabolic
chamber with a water jacket maintained at 37 °C(Hansa-
tech, Norfolk,...
- 9
- 622
- 0
Tài liệu Báo cáo khoa học: Models and mechanisms of O-O bond activation by cytochrome P450 A critical assessment of the potential role of multiple active intermediates in oxidative catalysis doc
Ngày tải lên :
19/02/2014, 16:20
... 11–813.
119. Wada, A. , Ogo, S., Watanabe, Y., Mukai, M., Kitagawa, T.,
Jitsukawa, K., Masuda, H. & Einaga, H. (1999) Synthesis and
characterization of novel alkylperoxo m ononuclear i ron(III)
complexes ... J.N., Corina, D. & Akhtar, M. (1996) The
mechanism o f the a cyl-carbon bond cleavage re action catalyzed
by recombinant sterol 1 4a- demethylase of Candida albicans.
(other names are: lanostero ... N-oxygenation of the tertiary arylamine at a rate
less than half that of the wild-type-catalyzed reaction [142],
so that reasonable interpretation o f the data seems d ifficult.
Evidence from comparative...
- 26
- 746
- 0
Tài liệu Báo cáo khoa học: Local stability identification and the role of a key aromatic amino acid residue in staphylococcal nuclease refolding pdf
Ngày tải lên :
20/02/2014, 01:20
... Institute of Physics, Academia Sinica, Taipei, Taiwan, ROC
3 Department of Biochemistry, University of Minnesota College of Biological Sciences, St Paul, MN, USA
Staphylococcal nuclease (SNase) is a ... folding pathway: structure-based analysis of
staphylococcal nuclease. Proteins: Structure, Function
and Genetics 27, 171–183.
15 Flanagan JM, Kataoka M, Fujisawa T & Engelman
DM (1993) Mutations ... Salmon testes
DNA and some analytical grade chemicals such as EDTA,
Tris ⁄ HCl, CaCl
2
, NaCl and mineral oil were obtained from
Sigma (St Louis, MO, USA). Salmon testes DNA for the
enzyme activity...
- 7
- 551
- 0
Tài liệu Báo cáo khoa học: A possible role of mitochondria in the apoptotic-like programmed nuclear death of Tetrahymena thermophila Takashi Kobayashi and Hiroshi Endoh docx
Ngày tải lên :
20/02/2014, 03:20
... T. Kobayashi and H. Endoh
5380 FEBS Journal 272 (2005) 53785387 ê 2005 FEBS
rial large subunit rRNA (mtLSUrRNA) gene: mtLSU-3, 5Â-
TACAACAGATAGGGACCAA-3Â; and mtLSU-4, 5Â-
CCTCCTAAAAAGTAACGG-3Â. ... & Vaux DL
(2000) Identification of DIABLO, a mammalian protein
that promotes apoptosis by binding to and antagonizing
IAP proteins. Cell 102, 43–53.
7 Suzuki Y, Imai Y, Nakayama H, Takahashi ... (A) Fractionation PCR. A partial fragment of the mitochond-
rial large subunit ribosomal RNA (23S rRNA) was amplified by PCR,
using fraction samples that contained equal amounts of protein.
Lane,...
- 10
- 642
- 0
Tài liệu Báo cáo khoa học: Electrostatic role of aromatic ring stacking in the pH-sensitive modulation of a chymotrypsin-type serine protease, Achromobacter protease I pdf
Ngày tải lên :
21/02/2014, 03:20
... the fact
that H21 0A and H210S are as active as native API with
VLK-MCA as a substrate (Table 1). This means that
Trp169 does not play a role as an electron-rich entity but as
a large planar hydrophobic ... Shiraki, School of Materials Science,
Japan Advanced Institute of Science and Technology, 1-1 Asahidai,
Tatsunokuchi, Ishikawa, 923-1292, Japan.
E-mail: kshiraki@jaist.ac.jp
Abbreviations:API,Achromobacter ... Asp113 and His210, rather than a catalytic
triad.
ACKNOWLEDGEMENT
We are grateful to Dr. T. Yamazaki for NMR measurements, Y. Yagi
for the amino acid analysis, and Y. Yoshimura for the sequence analysis.
REFERENCES
1....
- 7
- 603
- 0
Tài liệu Báo cáo Y học: Exploring the role of a glycine cluster in cold adaptation of an alkaline phosphatase pdf
Ngày tải lên :
22/02/2014, 04:20
... mutant alkaline phosphatases.
(A) Temperature dependence of k
cat
of TAB5 (d), mutants G26 1A
(r), G26 1A/ Y26 9A (j)andE.coli (·) alkaline phosphatases at
temperature range 5–25 °C. k
cat
values ... 1230–1238.
22. Garen, A. & Levinthal, C. (1960) A fine structure genetic and
chemical study of the enzyme alkaline phosphatase of E.coli.1.
Purification and characterization of alkaline phosphatase.
Biochim. ... higher value almost 2.5-fold higher than
the native cold adapted enzyme (Table 1). The mutant
G26 1A/ Y26 9A exhibits an E
a
almost the same as in the case
ofthenativeenzyme(Table1).
Thermal inactivation...
- 6
- 488
- 0
The Costs and Financial Benefits of Green Buildings: A Report to California’s Sustainable Building Task Force pptx
Ngày tải lên :
06/03/2014, 19:20
... California Department of Water Resources
Gary Estrada California Department of General Services, Office of Risk and Insurance
Management
Karen Finn California Department of Finance
Doug Grandy California ... Program
Sam Baldwin US Department of Energy
Panama Bartholomy California Department of General Services, Division of the State
Architect
John Blue California Integrated Waste Management Board
Bob ... renewable energy, such as the installation of over an acre of
photovoltaic panels on the roof of the Franchise Tax Board Building in Rancho Cordova
– which is the largest array on any state office...
- 134
- 772
- 0
Báo cáo khóa học: Mutational and computational analysis of the role of conserved residues in the active site of a family 18 chitinase docx
Ngày tải lên :
07/03/2014, 14:20
... glycosyl-
transferase elucidate catalysis in the alpha-amylase family. Nat.
Struct. Biol. 6, 432–436.
16. Terwisscha van Scheltinga, A. C., Armand, S., Kalk, K.H., Isogai,
A. , Henrissat, B. & Dijkstra, ... circulans, whereas it may be mutated to
asparagine without loss of activity in other family 18
chitinases [28,30]. Preliminary results of a comparative
study of available structures of family ... 2003
at four time points for each reaction (product formation was
linear for at least 20 min, at all substrate concentrations, at
almost all pH values and for all mutants). In this way kinetic
parameters...
- 10
- 651
- 0
Báo cáo khoa học: Trigger factor interacts with the signal peptide of nascent Tat substrates but does not play a critical role in Tat-mediated export pptx
Ngày tải lên :
07/03/2014, 16:20
... (5Â-ACGC
GGATCCAG
TCATAAACAGCGGTTGC-3Â, Bam HI site un derlined),
87SufI-BamHI-rv (5 Â-ACGC
GGATCCAACATCGTCGC
CCTTCCA-3Â, BamHI site underlined) and SufIHA-
XbaI+ClaI-rv (5Â-ACTG
ATCGATCTAGATTACGCAT
AGTCAGGAACATCGTATGGGTAGCCGCCTGGCG
GTACCGGATTGACCAAC- ... a s a template and the primers
RRTorA-SacI-fw (5Â-GCGCG
GAGCTCAAGAAGGA
AGAAAAATAATGAAC-3Â, SacI site underlined) and
TorA/Lep2-BamHI-rv (5Â-GCAT
GGATCCCGCGCGC
TTGATGTAATC-3Â, BamHI site underlined). ... stopcodons (TAG) that are suppressed
with (Tmd)Phe-tRNA
sup
are indicated. (B) In vitro tran slation of
57SufITAG8 an d 93SufITAG8. After translation, one hal f of each
sample was irradiated with...
- 9
- 393
- 0
Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx
Ngày tải lên :
07/03/2014, 21:20
... 5Â-CTAGACTCGAGCCTAAT
TTATATTTGCTCCTTGTGC-3Â. b-Actin primers were
designed as follows: forward 5Â-CTACAATGAGCTGCG
TGT-3Â and reverse 5Â-AAGGAAGGCTGGAAGAGT-3 ¢.
Cell survival and apoptosis analysis
For viability ... the
yeast two-hybrid assay and using a mammalian hybrid
system (Invitrogen, Carlsbad, CA) (EDA Wheeler &
V Ayyavoo, unpublished data). A blast search
revealed that the IMAGE clone, localized ... VBARP-mediated cell
survival
Caspases, a family of cysteine acid proteases, are cen-
tral regulators of apoptosis [12,13]. Caspases are rou-
tinely used as a measure of apoptosis, in contrast...
- 12
- 561
- 0
The Carbon and Global Warming Potential Impacts of Organic Farming: Does It Have a Significant Role in an Energy Constrained World? pptx
Ngày tải lên :
08/03/2014, 23:20
... may already offer
efficiencies, an aspect that requires more study. Finally, reducing transport offers some additional,
if smaller, potential for E and GHG gains (and again data for the Canadian ... survey, namely
the Organic Agriculture Centre of Canada, the Organic Value Chain Roundtable and Agriculture and
Agri-Food Canada.
References and Notes
1. Canning, P.; Charles, C .A. ; Huang, S.; ... al. [27] is somewhat atypical of many
current commercial organic crop production systems.
An LCA modeling analysis of a Canada-wide conversion to organic canola, wheat, soybean and
corn production...
- 41
- 524
- 1
