bending moments reactions and thrust due to a one side distributed load q within some portion of the arch tables a 11 and a 12
Báo cáo y học: " Femoral vein thrombophlebitis and septic pulmonary embolism due to a mixed anaerobic infection including Solobacterium moorei: a case report" ppt
... sites and an erythematous right groin, with bilateral groin sinuses and some lymphadenopathy on palpation Cardiovascular, respiratory and abdominal examination was unremarkable Analysis of blood ... vena cava and to the lungs We advocate the need for a high degree of clinical suspicion, an early diagnosis, and prompt institution of effective antimicrobial therapy to decrease the mortality and ... clinical and AK for laboratory work, all contributed to the writing of the article All authors have seen and approved the final manuscript Acknowledgements Conclusion Our case emphasizes the local...
- 3
- 192
- 0
Báo cáo Y học: Human bile salt-stimulated lipase has a high frequency of size variation due to a hypervariable region in exon 11 pot
... samples The fragment that was sequenced from mother D1 was shown to carry a 98-bp deletion that changes the reading frame of the gene and predicts a premature translational stop after 632 amino acids ... reaction to a ®nal concentration of M (Sigma, St Louis, MO, USA) A pair of primers, referred to as BSSL 12 and BSSL 14, was designed to cover the entire sequence of repeats (BSSL 12: 5¢-ACCAACTTCCT ... i.e after 610 amino acids In both cases the deletion changes the reading frame and predicts a new C-terminal tail (RAAHG) Besides the deletions, the sequences of D1 and D2 were identical to the...
- 9
- 520
- 0
báo cáo hóa học:" Validity of instruments to measure physical activity may be questionable due to a lack of conceptual frameworks: a systematic review" pot
... and abstracts AF and MP (1st reviewers) and EGS and JGA (2nd reviewers) assessed full texts of the identified studies and extracted the relevant data EGS, MP and JGA drafted the manuscript All authors ... 48:20-8 Letrait M, Lurie A, Bean K, Mesbah M, Venot A, Strauch G, Grandordy BM, Chwalow J: The Asthma Impact Record (AIR) index: a rating scale to evaluate the quality of life of asthmatic patients ... Additional file 1: Search strategy: MEDLINE, EMBASE, CINAHL and PSYCHINFO Outline of the search strategy used for electronic database searching List of Abbreviations APA: American Psychological Association;...
- 13
- 357
- 0
báo cáo khoa học: "Right subclavian vein catheterism complication due to a ‘foreign body’: a case report" ppt
... located at the right supraclavicular fossa was noted, so a computed tomography (CT) contrast scan was performed The results of the CT scan showed a small right supraclavicular fossa hematoma, ... [http://www.emedicinehealth.com/ venous_access_devices/page3_em.htm] Randolph AG, Cook DJ, Gonzales CA, Andrew M: Benefit of heparin in central venous and pulmonary artery catheters: a meta-analysis of randomized ... no active bleeding, and a triangular foreign body of metallic tomographic appearance, approximately mm in length, in the interstitial space between right subclavian vein and artery There was...
- 3
- 197
- 0
Báo cáo khoa hoc:" Acute jejunoileal obstruction due to a pseudopolyp in a child with undiagnosed crohn disease: A case report" doc
... deletion of p53 and ATM genes and the presence of the rearrangement of BCL6 gene This means that he is at high risk of developing a cancerous disease and may also develop malignant lymphoma and many ... fissures, granulomas, vascular dilatation, pseudopolyps, mucosal inflammation of the small and large bowel, and granulomas in local lymph nodes were observed The tip of the appendix was inflamed too ... intestinal surface and ulcers, two of which had parietal ruptures with fluid escape A resection of 45 cm of the ileo-jejunal portion, including all areas of intestinal damage, was performed and a primary...
- 3
- 271
- 0
Báo cáo y học: " Selective mutism due to a dog bite trauma in a 4-year-old girl: a case report" pot
... has also been reported after a traumatic experience such as sexual abuse [6], divorce and the death of a loved one [7] Its presence has been associated with impairment of the socialisation and ... and time of referral [5] Current management involves behavioural therapy, family therapy and in some cases pharmacotherapy [5] PTSD is a highly prevalent condition among children exposed to a ... highlights the necessity of health professional and parental awareness of post-traumatic psychiatric morbidity in children subsequent to a physical trauma Having knowledge of these disorders may be...
- 3
- 275
- 0
Báo cáo y học: " Massive hematuria due to a congenital renal arteriovenous malformation mimicking a renal pelvis tumor: a case report" doc
... loin pain, nausea and vomiting, and that of pulmonary embolism have substantially decreased Selective embolization of renal AVMs allows preservation of the renal parenchyma and therefore leads to ... KP is the head of the Department of Urology and was also responsible for the format and revisions of the manuscript IA and MP were the treating anaesthesiologists while TP and AF were the interventional ... computed tomography material, arterial phaseadminisAxial computed tomography scan after intravenous administration of iodinated contrast material, arterial phase A filling defect of soft tissue...
- 4
- 159
- 0
Báo cáo y học: "Commentary Arterial hypertension due to fructose ingestion: model based on intermittent osmotic fluid trapping in the small bowel" ppt
... secretion and sympathetic activity, as seen in postprandial hypotension [16,17] Renin secretion and enhanced sympathetic activity raise ADH and aldosterone secretions These hormones retain water and ... adequate water ingestion This can lead to a new balance that leads to an expanded ECF compartment and increased risk of arterial hypertension The risk can be higher in individuals with impaired ... days An individual that on average takes several HFCS soft drinks each day can make his colon prone to sustained increased sodium absorption, despite adequate sodium ingestion and more than adequate...
- 7
- 155
- 0
Báo cáo khoa học: Cloning and expression of the first nonmammalian interleukin-11 gene in rainbow trout Oncorhynchus mykiss pdf
... both the 5¢- and 3¢-UTR The major differences were a 26 bp insertion in the 5¢-UTR of the cDNA and an insertion of 12 repeats with a consensus of CCAATGATGATCCAAGAAATCCACACTACAG (31 bp) in the ... is relaced by ‘|’ and insertions indicated by ‘-’ The two insertions in the 5¢- and 3¢-UTR are underlined and the 13 repeats with a consensus of CCAATGATGATCCAAGAAATCCACACTACAG (31 bp) in the 3¢-UTR ... SIGNALP 3.0 [23] and the potential N-glycosylation site (NQT) are in bold and underlined The four potential poly (A) signals (AATAAA) in the 3¢-UTR and the TATA box in the 5¢-flanking region are...
- 12
- 511
- 0
Báo cáo toán học: " Some Applications of the Proper and Adjacency Polynomials in the Theory of Graph Spectra" docx
... spectrum-regular, a result already used by Van Dam in [10] Generalizing some results of Haemers and Van Dam [12] (for d = 3), and Garriga, Yebra, and the author [20] (for |Γd (u)| = 1), Garriga and the author ... alternating and adjacency polynomials, and their relation with the spectra and diameters of graphs, submitted [17] M .A Fiol and E Garriga, From local adjacency polynomials to locally pseudodistance-regular ... is easy to show, examples of walk-regular graphs are the vertex-transitive and/ or distance-regular graphs Let Γ be a τ -partially walk-regular graph with τ < d, and adjacency matrix A Consider...
- 27
- 283
- 0
Báo cáo khoa học: "Adenocarcinoma of the third portion of the duodenum in a man with CREST syndrome" pot
... stated that primary duodenal adenocarcinoma is one of the main causes of death in patients with FAP [11] A case of an early duodenal adenocarcinoma from a Brunner's gland has been reported [12] ... depicting a mass Computed tomography of the abdomen depicting a mass (arrows) in the duodenum was carried out Histological examination revealed a lowgrade duodenal adenocarcinoma of maximal diameter ... declare that they have no competing interests Authors' contributions GA, IV and CK carried out the surgical procedure and contributed to the design of the study; GA and AM gathered the data, drafted...
- 4
- 202
- 0
A student - based evaluation of the reading comprehension tasks in Tieng Anh 12 Nang Cao = Đánh giá của học sinh về các hoạt động đọc hiểu trong sách
... discussions of the study 24 M .A. Thesis CHAPTER 4: Results and Discussions 4.1 Quantitative data Overall Evaluation of the Reading Section Before analyzing the results of the quantitative and qualitative ... half of the total and the rest belongs to the Pre and Post reading ones The distribution of tasks is not even Examining the nature of the reading tasks helps the researcher to have preliminary ... access to many types of materials such as magazines, newspaper, works of fiction etc In term of reading capacity, they can understand the content of the text as a whole and they are capable of going...
- 63
- 911
- 0
Some observations of the effects of time on the capacity of piles driven in sand R. J. JARDINE, J. R. STANDING and F. C. CHOW†
... indicate that the potential effects of driving and grouting on the CPTs taken within m of C1s and JP1s axes are not resolvable against the background of the sites natural soil variability The availability ... reusing pre-installed aged foundations Equally, it is clear that piles driven in sand are damaged by failure and cannot carry the same loads as intact aged piles There are therefore clear problems ... are $8% higher than the equivalent static capacities Taken together, these additional data indicate static tension capacities of around 3150 kN for the 22 m CLAROM piles at around 20002100 days;...
- 19
- 449
- 0
The data is highdimensional The desire of projecting those data onto a lowerdimensional subspace without losing importance information regarding some characteristic of the original variables
... variables are parameterized conditional distributions Parameters of the functions are parameters of the graph Z Ghahramani, “Graphical model: Parameter learning” Earthquake Burglary Alarm Newscast ... Introduction to topic modeling The main way of automatic capturing the meaning of documents Topic: the subject that we talk/write about Topic of an image: a cat, a dog, airplane, … Topic in ... going off during an earthquake He concludes it is more likely that earthquake causes the alarm Earthquake Burglary Alarm Call Newscast Graphical Models An overview Graphical models (probabilistic...
- 57
- 200
- 0
SOME RESULTS OF THE NANOWIRES GROWTH ON GALIUM ARSENIC SUBSTRATE BY VLS METHOD SOME THEORETICAL ASPECTS OF THE GROWTH MECHANISMS AND ABNORMAL PHENOMENA
... increases by an amount dh and the radius of the contact area decreases by an amount dr, then the nanowire growth continues, the inclination angle (α) at the base of the nanowires increases from the zero ... situation could be modeled for GaAs substrate II.2 The shape of the Au droplet The shape of the Au droplet is crucial for nanowire growth by VLS method The shape of a catalyst particle at the ... making the Au contact on GaAs semiconductor [10, 11] , here the Authors have also stated that the low-temperature formation of voids in the gold lattice and crystallite growth on the gold surface,...
- 6
- 333
- 0
Báo cáo khoa học: "Gastric outlet obstruction due to adenocarcinoma in a patient with Ataxia-Telangiectasia syndrome: a case report and review of the literature" pdf
... Spinocerebellar degeneration Ataxiatelangiectasia and malignant tumour [Japanese] Naika no Ryôiki (Domain of Internal Medicine) 1975, 35:623-626 Watanabe A, Hanazono H, Sogawa H, Takaya H: Stomach cancer ... adenocarcinoma that was resected Case presentation The patient is a 20 year old female that was diagnosed with ataxia-telangiectasia syndrome at years of age She had severe ataxia and was wheelchair ... markedly dilated stomach, abnormal thickening in the region of the antrum and pylorus of the stomach, and adjacent pancreas thinned due to compression from dilated stomach There was no intraabdominal...
- 5
- 598
- 0
Báo cáo khoa học: "Acute liver failure due to primary angiosarcoma: A case report and review of literature" doc
... Histopathology evaluation, further study of slides and in depth analysis SRB – Critical revision and final approval of the version to be published All authors read and approved the final manuscript ... fulminant hepatic failure: presentation of a case and review of the literature Eur J Gastroenterol Hepatol 2003, 15 :123 5-40 Tanaka M, Watanabe S, Masaki T, Kurokohchi K, Kinekawa F, Inoue H, Uchida ... selection, analysis and drafting the manuscript ANB – Case analysis and initial drafting of manuscript GS – Contributions to conception, arranging histopathology, revision of the manuscript SGH – Histopathology...
- 5
- 502
- 0
Báo cáo y học: "Adrenal suppression due to an interaction between ritonavir and injected triamcinolone: a case report" docx
... roenterogram of the pelvis and left hip was obtained and revealed a large area of avascular necrosis within the left femoral head with significant lateral cortical lucency Four months later, a mid-morning ... injection of triamcinolone acetonide while they were also receiving the fixed-dose combination of emtricitabine and tenofovir plus ritonavir and atazanavir They had no history of concomitant inhaled, ... http://www.aidsrestherapy.com/content/6/1/10 tration was 693/μL and her viral load was undetectable She had been vaccinated against hepatitis A and B and was not infected with hepatitis C Upon presentation...
- 4
- 454
- 0
Báo cáo y học: "Cardiac surgery in a patient with retroperitoneal fibrosis and heart valvulopathy, both due to pergolide medication for Parkinson''''s disease" pps
... ureteral catheters are showing (white arrows) while the annulus of the mechanical valves (black arrow) and the wires of the epicardial pace maker are also seen All authors: have made substantial ... Valvular heart disease and the use of dopamine agonists for Parkinson's disease N Engl J Med 2007, 356:39-46 Yamamoto M, Uesugi T, Nakayama T: Dopamine agonists and cardiac valvulopathy in Parkinson's ... is unclear and may be related to the lower pergolide doses used in Asian patients There are only a few reported cases of patients who had surgery for cardiac disease acquired due to medications...
- 3
- 308
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008