behaviour of clocks and measuring rods on a rotating body of reference

Báo cáo khoa học: Structural and serological studies on a new 4-deoxy-D-arabino-hexosecontaining O-speciﬁc polysaccharide from the lipopolysaccharide of Citrobacter braakii PCM 1531 (serogroup O6) pptx

Ngày tải lên : 23/03/2014, 17:22

... Serological methods Rabbit antisera against Citrobacter strains PCM 1531 and PCM 1487 were prepared as described previously [21] Passive haemagglutination and inhibition of passive haemagglutination ... Part of a two-dimensional 1H,13C HSQC spectrum of the O-specific polysaccharide (OPS) of Citrobacter braakii PCM 1531 One-dimensional 1H and 13C NMR spectra are displayed along the horizontal and ... conclusion was confirmed and the a configuration of ara4dHex established using a NOESY experiment This showed H1,H3 and H1,H5 correlations for Rha at d 4.97/4.06 and 4.97/3.58, which are characteristic...

7
478
0

formation of zno thinfilms consisting of nano-prisms and nano-rods with a high

Ngày tải lên : 06/05/2014, 13:23

... positively charged Zn (0001) and negatively charged O (000l) surfaces, resulting in a normal dipole moment and spontaneous polarization along the c-axis as well as a variance in surface energy ... sharp without any indication of an interfacial reaction or any formation of amorphous compounds The SAED pattern showed that the ﬁlm was c-axis oriented in the substrate normal direction with a ... Tokyo, Japan) The crystallographic information was obtained by X-ray diffraction (XRD, X’pert PRO, Philips, and Eindhoven, Netherlands) The microstructure and crystallographic orientation of the...

5
274
0

Tài liệu DSXi™ Panels and Bays Connecting on a Whole New Level doc

Ngày tải lên : 21/12/2013, 07:15

... can save valuable floor space By configuring a low-profile 84-circuit DSXi panel measuring only four inches high, you can increase your bay capacity from 11 standard panels to 14—for a total of ... sophisticated, DSX panels remain at the very heart of networks That’s why ADC, The Broadband Company™ and the industry’s leading supplier of DSX-1 equipment, continues to innovate and enhance traditional ... traditional DSX panels to improve density, manageability, and delivery Take a look at DSXi from ADC It’s connecting on a whole new level increased density Connect with DSXi panels and bays, and you...

6
378
0

Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt

Ngày tải lên : 18/02/2014, 14:20

... made up of a nine-stranded b-sheet ﬂanked by a1 , a5 and g2 on one side and by a2 , a3 , a4 and g1 FEBS Journal 275 (2008) 5855–5864 ª 2008 The Authors Journal compilation ª 2008 FEBS A Pappachan ... template using Deep Vent DNA polymerase (New England Biolabs, Ipswich, MA, USA), a sense primer (CATATGGCTAGC ATGCGCATATTGCTGAGTAAC) containing an NheI site and an antisense primer (TTAGGATCCTTACCATTGCG ... towards pNPP at an acidic pH, around 5.5, and Tt SurE was maximally active at pH 8.2 St SurE shows almost no activity in the absence of divalent metal ions Activation by various metal ions was...

10
553
0

The 1998 bleaching event and its aftermath on a coral reef in Belize doc

Ngày tải lên : 07/03/2014, 17:20

... shelf lagoon, as well as on the outer barrier reef and in the lagoon at Glovers Reef, an atoll-like carbonate platform seaward of the barrier reef (McClanahan and Muthiga 1998; Aronson and Precht ... the manuscript, as did the comments of an anonymous reviewer M .A. Toscano acknowledges the assistance of R.P Stumpf (NOAA/National Ocean Service) and K.S Casey (NOAA/National Oceanographic Data Center) ... components for graphical representation and as proportional covers for statistical analysis Repeated-measures analysis of variance (ANOVA) was used to compare the proportional covers of individual...

13
583
0

Báo cáo y học: "Surgical and medical emergencies on board European aircraft: a retrospective study of 10189 cases"

Ngày tải lên : 25/10/2012, 10:31

... Germany, the regulations of the National Federal Aviation Agency (Luftfahrt-Bundesamt, Braunschweig, Germany) and the European Joint Aviation Authorities (JAA; Cologne, Germany) regulate aviation ... encountered was a lack of standardisation in terms of diagnostic categorisation and confirmed diagnostic data This was reflected in the fact that only four out of 32 airlines were able to contribute ... 2007 on board European aircraft Materials and methods This study originates from the surgical department of an academic teaching hospital (Department of General and Visceral Surgery, Augusta Krankenanstalt,...

6
639
0

A comparative study of discourse structures and some major linguistic features of international declarations and international conventions on human rights part 1

Ngày tải lên : 07/11/2012, 14:17

1
664
4

A comparative study of discourse structures and some major linguistic features of international declarations and international conventions on human rights part 2

Ngày tải lên : 07/11/2012, 14:17

... COMPARISON WITH THOSE OF THE INTERNATIONAL DECLARATION 4.1 Definition of an International Convention 4.2 20 Purposes and typical legal characteristics of the International Convention on Human Rights 20 ... 5.2 Similarities 34 * Typical structure of an International Declaration on Human Rights 37 * Typical structure of an International Convention on Human Rights 38 * Sources of data 39 * References ... structure and some major linguistic features of the International Declaration on Human Rights 3.3.1 11 11 3.3.1.2 Remarks 12 The Body 13 3.3.2.1 The Body of the Declaration and its realization 13...

6
634
0

A comparative study of discourse structures and some major linguistic features of international declarations and international conventions on human rights part 3

Ngày tải lên : 07/11/2012, 14:17

... Evidence and Justification, Relation of Cause, Purpose, Condition and Otherwise, Interpretation and Evaluation, Restatement and Summary, and lastly Sequence and Contrast The types of relation between ... INTERNATIONAL DECLARATION ON HUMAN RIGHTS 10 3.1 DEFINITION OF AN INTERNATIONAL DECLARATION 'International Declaration' generally is defined as "a formal statement agreed on or used by all or many ... - Each Declaration is drawn up based on the common consent of sides - Each Declaration is promulgated and adopted by a right authoritative agency - Each Declaration is an international legal...

41
839
3

A comparative study of discourse structures and some major linguistic features of international declarations and international conventions on human rights part 4

Ngày tải lên : 07/11/2012, 14:17

... education accessible to all on the basis of capacity by every appropriate means; (d) Make educational and vocational information and guidance available and accessible to all children; (e) Take ... spirit of article 29; (b) Encourage international co-operation in the production, exchange and dissemination of such information and material from a diversity of cultural, national and international ... social security and is entitled to realization, through national effort and international co-operation and in accordance with the organization and resources of each State, of the economic, social...

28
611
0

Effect of periodic suction on three dimensional flow and heat transfer past a vertical porous plate embedded in a porous medium

Ngày tải lên : 05/09/2013, 14:58

... reviewed a good number of research papers of some International Journals Dr Das is currently acting as the honorary member of editorial board of Indian Journal of Science and Technology and as Referee ... Conclusion From the above analysis, we summarize the following results of physical interest on the velocity and temperature of the flow field and also on skin friction and the rate of heat transfer ... transfer effects on unsteady flow past an accelerated vertical porous plate with suction Bull Malays Math Sci Soc 2006, 29(1), 33-42 [15] Das S S., Satapathy A. , Das J K., Panda J P Mass transfer...

12
493
0

Optimization of design and operating parameters on the year round performance of a multi-stage evacuated solar desalination system using transient mathematical analysis

Ngày tải lên : 05/09/2013, 16:11

... variation of global solar radiation and ambient temperature at Chennai for January to June _ Solar radiation -Ambient temperature Figure Mean monthly hourly variation of global solar radiation ... latent heat of condensation The outlet temperature from the flat plate collectors, latent heat and refined latent heat of vaporization of water from each stage and specific heat capacity of water ... performance Each evaporator and condenser tray has an area of 1m2 inclined at an angle of 16o (a) (b) Figure Coupling of Multi-stage evacuated solar desalination system to flat plate collectors; (a) ...

26
568
0

A study on group discussion and its impacts on speaking ability of the non major students at the post elementary level in military science academy

Ngày tải lên : 07/09/2013, 13:02

... that teachers should arrange situations in which a balance is made between “syntactic and lexical modes of communication” on one hand, while maintaining that balance between “conservative and ambitious ... participants, and procedures, instrumentation and data collection Methods of analysis will be addressed in Chapter Four Analysis of a range of data collected from various sources (oral data from ... terms of phonetics and morphology Also, Vietnamese language is a mono-language and most of its syllables not end in consonants (except some nasal and voiceless stop consonants), so this may result...

77
890
5

Slide a study on group discussion and its impacts on speaking ability of the non major students at the post elementary level in military science academy

Ngày tải lên : 29/01/2014, 10:33

... Department at MSA - Nature of group work - Relationship between group work and individual presentation Objectives of the study  contribute more theory to the understandings of group discussion  find ...  age : 21 – 24  Sex : male Instrumentation Audio – recording Questionnaire Observation note The implementation of the study  Time : 10 weeks  Total number of participants: 16  Number of ... group Group Data Analysis Language Related Episodes  Form-based LREs (F - LREs)  Lexis-based LREs (L - LREs)  Mechanics-based LREs (M - LREs)  Leadership move Individual Data Analysis  Error...

15
798
0

Tài liệu Freedom of Expression on the Internet - A study of legal provisions and practices related to freedom of expression, the free flow of information and media pluralism on the Internet in OSCE participating States ppt

Ngày tải lên : 18/02/2014, 00:20

... effectiveness of state laws, and lack of harmonization at the international level a number of states have started to block access to websites and social media platforms that allegedly contain illegal content ... participating States Albania, Armenia, Austria, Azerbaijan, Belarus, Bosnia and Herzegovina, Bulgaria, Canada, Croatia, Cyprus, Czech Republic, Denmark, Estonia, Finland, France, Georgia, Germany, Greece, ... disadvantages of various international and national content regulation measures – particularly vis-à-vis fundamental rights of free expression and media freedom and 3) by taking into account international...

238
2.7K
0

Tài liệu Youth Safety on a Living Internet: Report of the Online Safety and Technology Working Group pptx

Ngày tải lên : 18/02/2014, 00:20

... technological mandates and instead enhance funding and encourage collaborative, multifaceted, and multi-stakeholder initiatives and approaches to enhance online safety via innovation and cooperation ... author and media professor at the University of Southern California, also cautioned us against sensationalist media coverage of digital teens He said that what he and his fellow researchers of ... Technology and Innovation and a member of the National Economic Council, called on this Group to focus on research-based education – of both parents and children – as a key to children’s online safety...

148
435
0

Tài liệu Báo cáo khoa học: Modeling of tRNA-assisted mechanism of Arg activation based on a structure of Arg-tRNA synthetase, tRNA, and an ATP analog (ANP) ppt

Ngày tải lên : 18/02/2014, 11:20

... no means in a conformation that is fit to activate The fact that kcat and Km for tRNAArg in the aminoacylation reaction not change in the Asn106 fi Ala, Gln111 fi Ala and Phe109 fi Ala mutants of S ... codon usages for AGA and AGG codons are 19 and 34, respectively, and they amount to 98% among six codons for Arg The D-loops of isoacceptor tRNAUCU and tRNACCU contain nine (AGCAGGAC20aA) and ... under a linear gradient of NaCl from to m gave a pure tRNAArg transcript, which was precipitated by addition of ethanol Aminoacylation reaction The aminoacylation reaction of tRNA was measured at...

17
512
0

Tài liệu Báo cáo khoa học: Analysis of proteins and peptides on a chromatographic timescale by electron-transfer dissociation MS ppt

Ngày tải lên : 18/02/2014, 16:20

... resulting radical anion abstracts a proton and generates a radical site that triggers dissociation to produce a complementary pair of fragment ions of type c¢ and z¢Æ Subtraction of the m ⁄ z values ... Journal compilation ª 2007 FEBS 6271 ETD-MS analysis of peptides and proteins N D Udeshi et al dimethylation of Arg, monomethylation, dimethylation and trimethylation of Lys, acetylation and ubiquitination ... limitations [3] For ETD, radical anions of polyaromatic hydrocarbons, such as ﬂuoranthene, are formed under chemical ionization conditions, stored in a quadrupole linear ion trap (QLT) mass spectrometer,...

8
578
0

Tài liệu Báo cáo khoa học: Temperature and phosphate effects on allosteric phenomena of phosphofructokinase from a hibernating ground squirrel (Spermophilus lateralis) pptx

Ngày tải lên : 19/02/2014, 16:20

... to a value of 7.3 dramatically altered the effect of phosphate and activation was seen only at low concentrations with a maximal 1.7-fold activation at mm phosphate At 121 Temperature effects on ... 37 °C was 7.2 The concentration of Mg.ATP was held at 0.5 mM All other assay conditions are detailed in the Materials and methods Data are means ± SEM, n ¼ separate determinations Temperature ... probably due to temperature alone Sensitivity to adenylates (ATP inhibition, AMP and ADP activation) was reduced when the enzyme was assayed at °C, a temperature characteristic of hibernation, as...

9
579
0

Tài liệu Biodiversity and Local Perceptions on the Edge of a Conservation Area, Khe Tran Village, Vietnam doc

Ngày tải lên : 21/02/2014, 04:20

... Pe A xop A ro Huen Pa lar Tu vien Poaceae/bamboo Calamus walkeri /rattan Acacia auriculiformis/Acacia Musaceae/banana Wendlandia glabrata/tree Licuala spinosa/Licuala palm Tarrietia javanica/tree ... 935 A chuh Rana Chooh Rana Mỏ zeeng Along papứt Along cacet Câm foong fứt Description Land for garden Land for agriculture Land for peanut farming Land for forest plantation Land for cemetery Land ... Poaceae Calamus walkeri Acacia auriculiformis Musaceae Wendlandia glabrata Licuala spinosa Tarrietia javanica Cleistanthus aff myrianthus Melocalamus compactiflorus Afzelia xylocarpa Tools The...

118
556
0