behavior and lifestyle translate into a risk for obesity and altered body fat distribution
báo cáo khoa học: " Fish-hook injuries: a risk for fishermen" ppt
... 6:28 range of removal techniques available such as retrograde, needle cover, advance and cut, string yank and vertical eyelid-splitting [9] Considering that medical literature contains many cases ... contamination Consent statement Written informed consent was obtained from the patient for publication of this case report and accompanying images A copy of the written consent is available for ... literature sources AMI managed the data collection and contributed to writing the paper All authors read and approved the final manuscript Competing interests The authors declare that they have no competing...
- 2
- 149
- 0
Institutional sources transforming crises into a springboard for innovations
... is static, this implies that learning and human capital is also static in time and at a certain level In reality, R&D is constantly evolving and the ability to learn and the human capital built ... US-based companies (Black & Veatch and CH2MHill) and Netherlands-based company (Deltares) Table 2.7 Leading Japanese suppliers# of advanced membranes to Singapore NEWater factories NEWater Factory ... the water loop Today, Singapore’s water supply is made of the Four National Taps – imported water, local catchment, NEWater and desalinated water Singapore boasts of a diversified and sustainable...
- 98
- 214
- 0
A Manual for Integrating Gender Into Reproductive Health and HIV Programs: FROM COMMITMENT TO ACTION pptx
... sex-disaggregated micro- and macro-economic data and national statistics on social development Information about labor force participation and segmentation, incomes, poverty rates, educational attainment, ... increasing demand for family planning information and services; expanding options for fertility regulation and the organization of family planning information and services; integrating family planning ... a philosophy that allows participants to understand and examine local practices in a non-judgmental way; to receive new, especially technical, information in a way that they can understand; and...
- 71
- 608
- 0
Báo cáo khoa học: Complexes of Thermoactinomyces vulgaris R-47 a-amylase 1 and pullulan model oligossacharides provide new insight into the mechanism for recognizing substrates with a-(1,6) glycosidic linkages docx
... A, Ohtaki A, Kaji A, Tonozuka T & Sakano Y (2002) Crystal structures of Thermoactino˚ myces vulgaris R-47 a- amylase (TVA I) at 1.6 A reso˚ resolution lution and a- amylase (TVA II) at 2.3 A J Mol ... Structure of a- amylase with pullulan model ligand A Abe et al Fig Chemical structures of the repeat units of pullulan, P2 and P5 A solid arrow indicates the main hydrolysing site, and a dashed arrow ... corresponding amino acid residue in other a- amylases Thus, Phe313 is a key residue for the recognition of both starch and pullulan as a substrate Structural comparison of the catalytic site between TVAI and...
- 9
- 342
- 0
A Manual for Integrating Gender Into Reproductive Health and HIV Programs: From Commitment to ACtion (2nd edition) ppt
... Manual include RH program managers and technical staff of USAID and its implementing partners, as well as governmental organizations (GOs), and international and local nongovernmental organizations ... financial resources and power are fundamental to their capacity to access and use health information, make informed decisions about their health and fertility, and to negotiate and insist on safe ... information identified in different domains that may facilitate Table 4.1 A Framework for Gender Analysis (Data Collection and Analysis) DATA COLLECTION AND SYNTHESIS-Step I DATA COLLECTION AND...
- 88
- 544
- 0
Guidance on Responsible business in conflict-affected and HiGH-Risk aReas: a ResouRce foR companies and investoRs potx
... humanitarian and criminal law may accompany violent conflict, and can be both a cause and a consequence of conflict and instability What may begin as apparently “one off” abuse can escalate In ... create reputational, operational, and financial risks for companies and investors Engagement with companies operating in conflict-affected and high -risk areas can increase investors’ understanding ... place national legislation and institutions, establish export, import and internal controls and commit to transparency and the exchange of statistical data Participants can only legally trade...
- 48
- 390
- 0
Báo cáo y học: "Protein, iron, and meat consumption and risk for rheumatoid arthritis: a prospective cohort study" pps
... median intake of each nutrient in each quintile as a continuous variable eAnimal and vegetable protein were adjusted for each other, total iron, and for the same variables adjusted for in all ... concept and design, data collection and analyses, and manuscript writing and editing DF contributed to the data analyses and statistical support, as well as to the manuscript writing and editing ... multivariate models fTotal iron was adjusted for total protein as well as for the same variables adjusted for in all the multivariate models gDietary and supplemental iron were adjusted for each...
- 8
- 340
- 0
Báo cáo y học: "Proton-pump inhibitors are associated with a reduced risk for bleeding and perforated gastroduodenal ulcers attributable to non-steroidal anti-inflammatory drugs: a nested case-control study" pptx
... of the univariate or multivariate analyses Table Multivariate analysis of significant variables and other likely causational variables for serious NSAID ulcer complications Predictor Adjusted OR ... Gonzalez-Perez A, et al.: Effect of antisecretory drugs and nitrates on the risk of ulcer bleeding associated with nonsteroidal anti-inflammatory drugs, antiplatelet agents, and anticoagulants Am ... RWF also contributed to the selection and inclusion of cases and controls JvdP also contributed to the statistical analysis of the data All authors read and approved the final manuscript Acknowledgements...
- 8
- 459
- 0
Báo cáo y học: " Draft genome sequence of the Daphnia pathogen Octosporea bayeri: insights into the gene content of a large microsporidian genome and a model for host-parasite interactions" pps
... Nosema ceranae 100 Nosema ceranae 100 Encephalitozoon cuniculi Antonospora locustae 99 100 97 100 Paranosema grylli ATP transporters Clade I Antonospora locustae Antonospora locustae Ancestral ATP ... of evolutionary ecology into the post-genomic era Materials and methods DNA and RNA extraction and DNA sequencing Total RNA and genomic DNA from O bayeri (isolate OER 33 from the Island Oeren in ... contributed major scientific ideas and drafted the manuscript KLH cultured O bayeri strains and provided DNA and RNA samples required for sequencing JFP performed bioinformatics analyses and drafted...
- 12
- 400
- 0
báo cáo khoa học: " Translating research into practice in Leeds and Bradford (TRiPLaB): a protocol for a programme of research" ppsx
... organisation) to translate research-based findings into practice in the areas of maternal mental health and stroke care, and with Leeds Partnership Foundation Trust (a provider of mental health ... Airedale, stakeholder consultation in the area of child and maternal health care with a range of commissioners and practitioners revealed the importance of maternal mental health as a focus for activity ... [11,20] The data will be analysed using a framework approach [21]: familiarisation with the data, identification of a thematic framework, indexing, charting, and finally, mapping and interpretation...
- 6
- 230
- 0
báo cáo khoa học: " Implementing and evaluating a regional strategy to improve testing rates in VA patients at risk for HIV, utilizing the QUERI process as a guiding framework: QUERI Series" pptx
... assistants, and post-graduate medical trainees) from the primary care administration staff at Facilities A and B The data on provider types were used to compare HIV testing and evaluation performance across ... and sub-station levels – and for clustering We have obtained information regarding all inpatient and outpatient patient encounters within VISN 22 from a preestablished network database For patients ... materials such as e-mail communications, pocket cards, posters and flyers, and removal of organizational barriers) are the same at all stations The audit feedback program is directed at all providers...
- 13
- 341
- 0
báo cáo khoa học: " Implementing and evaluating a regional strategy to improve testing rates in VA patients at risk for HIV, utilizing the QUERI process as a guiding framework: QUERI Series" docx
... assistants, and post-graduate medical trainees) from the primary care administration staff at Facilities A and B The data on provider types were used to compare HIV testing and evaluation performance across ... and sub-station levels – and for clustering We have obtained information regarding all inpatient and outpatient patient encounters within VISN 22 from a preestablished network database For patients ... materials such as e-mail communications, pocket cards, posters and flyers, and removal of organizational barriers) are the same at all stations The audit feedback program is directed at all providers...
- 13
- 588
- 0
báo cáo khoa học: " Targeted isolation, sequence assembly and characterization of two white spruce (Picea glauca) BAC clones for terpenoid synthase and cytochrome P450 genes involved in conifer defence reveal insights into a conifer genome" pdf
... (shown in 5'-3' orientation) are CTTTCAAGCCCAATACCCAAAGGCACTG and GGGAATGGCAATCACTGCATTGGTATAG for CYP720B4; and GGAGAATTAGTGAGTCATGTCGATG and CTCTGTCTGATTGGTGGAACAGGC for 3CAR PCR products from ... and PGB04 (AACAAATTTACTCATTTA CCCGTGA, CCCATCAAAATCCATGCCCAAG, TTCCAAGTTCTTGTGGGAGGAG, GACTGATTTTCTCTCCACCAAGCAAG) Sequence analysis Repetitive DNA was identified with the RepeatMasker software ... on the BAC scaffolds of PGB02 (3CAR) (ACCCATCTTCACAAAATTAC, GTAGTCCATAACGAGCAGAA) and PGB04 (CYP720B4) (TGATATTTGGTCTGCCATGGGCG, CATTTCCCTGCATGTATTCAATGCC, CCACCACATAGTTAGACCGTGATGC) Authors'...
- 13
- 329
- 0
Báo cáo y học: "Is Phytalgic® a goldmine for osteoarthritis patients or is there something fishy about this nutraceutical? A summary of findings and risk-of-bias assessment" pot
... supports a low risk of performance bias as the authors state that the manufacturer provided both the Phytalgic® and placebo capsules and that it claimed that they were identical and indistinguishable ... from Abbott (Abbott Park, IL, USA), Amgen (Thousand Oaks, CA, USA), Astellas Pharma (Tokyo, Japan), Axellus (Oslo, Norway), Bristol-Myers Squibb Company (Princeton, NJ, USA), Cambridge Manufacturing ... on OA in smaller studies, later and presumably more strictly led RCTs with less bias have claimed results that are more moderate, with an anticipated overall ES on pain of –0.33 standard deviation...
- 3
- 279
- 0
Báo cáo y học: "Hyperuricemia and the risk for subclinical coronary atherosclerosis - data from a prospective observational cohort study" potx
... raw data sets and takes responsibility for the integrity of the data and the accuracy of the data analysis Takeda Pharmaceuticals International, Inc did not have access to the raw data, and Takeda ... 114:1761-1791 Tanaka M, Tomiyasu K, Fukui M, Akamabe S, Kobayashi-Takenaka Y, Nakano K, Kadono M, Hasegawa G, Oda Y, Nakamura N: Evaluation of characteristics and degree of remodeling in coronary atherosclerotic ... antioxidant defense in humans against oxidant- and radical-caused aging and cancer: a hypothesis Proc Natl Acad Sci USA 1981, 78:6858-6862 Gagliardi AC, Miname MH, Santos RD: Uric acid: a marker...
- 8
- 350
- 0
Báo cáo y học: "Respiratory rehabilitation after acute exacerbation of COPD may reduce risk for readmission and mortality – a systematic review " ppt
... burden for patients and health care systems For patients, acute exacerbations are a common reason for hospital admissions and severely affect health-related quality of life (HRQL) [1] and prognosis[2] ... aim was to conduct a systematic review of all randomized controlled trials that compared respiratory rehabilitation after acute exacerbation and usual care Inclusion criteria We included randomized ... third party arbitration Data extraction and quality assessment We performed the data extraction using pilot-tested data forms One reviewer extracted details about study patients, interventions and...
- 12
- 259
- 0
Báo cáo y học: "Early postoperative hyperglycaemia is not a risk factor for infectious complications and prolonged in-hospital stay in patients undergoing oesophagectomy: a retrospective analysis of a prospective trial" ppsx
... vascular disease such as those with acute myocardial infarction and acute stroke, and in those who have undergone cardiovascular bypass surgery and peripheral vascular surgery [12-16] Few patients ... data collection, data analysis and writing of the manuscript JHDV participated in data analysis and writing of the manuscript JBH participated in the design of the study, data collection, data ... regression analysis was used for infectious complications, and linear regression analysis was used for length of stay Because of nonparametric distribution, length of stay data were logarithmically transformed...
- 6
- 368
- 0
Báo cáo y học: "Analysis and evaluation of environmental tobacco smoke exposure as a risk factor for chronic cough" docx
... Furusho S, Kita T, Katayama N, Abo M, Ohkura N, Herai Y, Hori A, Ishiura Y, Nobata K, Ogawa H, Yasui M, Kasahara K, Nakao S: Comparison of cough reflex sensitivity after an inhaled antigen challenge ... men For women, significant values were found for heavy ETS exposure in small spaces and in large indoor areas and for total ETS exposure [60] Figure search for the terms cough and tobacco and ... between ETS for respiratory diseases such as adult and pediatric asthma Also a series of epidemiological analyses on parental smoking and respiratory health in children have been performed [60,64,65,4,66-71]...
- 6
- 304
- 0
Báo cáo y học: "Asthma is a risk factor for acute chest syndrome and cerebral vascular accidents in children with sickle cell disease" ppt
... intermittent asthma, each with mild persistent and moderate persistent asthma, and with severe persistent asthma No patient had Page of (page number not for citation purposes) Clinical and Molecular Allergy ... infiltrates or arterial hypoxemia The study excluded children with an exacerbation of reactive airways disease If patients with sickle cell disease are at increased risk of airway inflammation and ... Additionally, spirometry was not routinely performed during ED and hospital admissions Although other EDs and hospitals in the metropolitan area evaluate, treat, and admit pediatric patients with asthma...
- 5
- 288
- 0
Báo cáo y học: "Assessment of balance and risk for falls in a sample of community-dwelling adults aged 65 and older" potx
... Drusini AG, Eleazer GP, Caiazzo M, Veronese E, Carrara N, Ranzato C, Businaro F, Boland R, Wieland D: One-leg standing balance and functional status in an elderly community-dwelling population ... costs were as follows: 1) materials for posters and flyers, approximately $10; 2) travel and time for research staff preparing materials, making presentations at senior centers and talking with ... interpretation of the results and writing of the paper MC recruited participants and coordinated the project SH did the data management CH and JKH led the writing of the paper, and all authors read and...
- 8
- 372
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến dòng điện stato i1 fi p2 phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25