becoming more therapeutic motivational interviewing as a communication style for paraprofessionals in juvenile justice settings
Human embryonic stem cells as a cellular model for osteogenesis in implant testing and drug discovery
... OCT4 F: CGRGAAGCTGGAGGAGAAGGAGAAGCTG 55 oC R: AAGGGCCGCAGCTTACACATGTTC NANOG F: GGCAAACAACCCACTTCTGC 55 oC R: TGTTCCAGGCCTGATTGTTC β-ACTIN F: ACAGAGCCTCGCCTTTGCC 58 oC R: ACATGCCGGAGCCGTTGTC 2.1.5 ... schizophrenia, Alzheimer‘s disease, Cancer, spinal cord injuries, diabetes and many more, stem cells may also materialized the hope of growing limbs and organs in laboratory for transplantation in future ... 488 goat anti-mouse secondary antibody 21 (1:200, Invitrogen) for detection Gold antifade reagent mounting (containing Dapi, Invitrogen) was performed to stain the nucleus Staining was examined...
- 117
- 385
- 0
tóm tắt a study on vietnamese english code switching as a communication device in coversations at workplaces
... to talk about a particular topic in one language rather than in another It was very interesting to find that the working staff in the field of international scholarship and studying abroad used ... social meanings b Intrasentential versus Intersentential Code-switching Language alternation within a sentence is known as intrasentential CS while language alternation across sentence boundaries ... questionnaire to 200 participants from companies, offices and workplaces in Hue, Da Nang city and Quang Nam province Secondly, the study was also based on the data from audio recordings of naturally...
- 26
- 394
- 0
Novel design of a compacted micro-structured air-breathing PEM fuel cell as a power source for mobile phones
... parameters for the base case operating conditions are taken from ref [10] and are listed in Table The geometric and the base case operating conditions are listed in Table In order to gain some insight ... 0) and condensation ( m phase < 0) is assumed Where m phase is mass transfer: for evaporation & & & & ( m phase = mevap ) and for condensation ( m phase = mcond ) (kg/s) So that the mass balance ... key parameters affecting fuel cell performance The model accounts for both gas and liquid phase in the same computational domain, and thus allows for the implementation of phase change inside...
- 18
- 549
- 0
Assessment of pretreatments and enzymatic hydrolysis of wheat straw as a sugar source for bioprocess industry
... efficient xylan hydrolysis such as α-arabinofuranosidases and α-Larabinases that release arabinan [31], α-glucuronidases that release glucoronic acids, acetyl xylan esterases that hydrolyze acetylester ... precipitate and separate the fractionated biomass The pretreatment has an advantage of operating at low temperature (50 °C) which capital and operating costs and minimizes degradation reactions ... Wax consists of primarily long chain fatty acids and fatty alcohols, sterols and alkanes Natural waxes have a wide range of industrial uses in cosmetics, polishes and coatings, pharmaceuticals,...
- 20
- 437
- 0
A study of using english songs as a type of supplementary material in teaching listening for first year non major students of english at phuong dong university
... time for the test was within fifteen minutes During the test, the teacher worked as a cassette player and examiner The marking was done with the same way of assessment and then was analyzed in ... research was conducted as a qualitative study, using questionnaire and interview, along with the test to collect data Maykut and Morehouse (1994) define qualitative research as generally examining ... identify and understand what others are saying This involves understanding a speaker's accent or pronunciation, his grammar and his vocabulary, and grasping his meaning Defined with those characteristics,...
- 39
- 1,125
- 3
Tài liệu Traumatic Gynecologic Fistula as a Consequence of Sexual Violence in Conflict Settings: A Literature Review doc
... as a war crime and rape punished as an act of genocide, by the UN International Criminal Tribunal for Rwanda Since then, in 2001, the International Criminal Tribunal for the former Yugoslavia ... states: “If indicated, a recto-vaginal examination and inspect the rectal area for trauma, recto-vaginal tears or fistulas, bleeding and discharge” (WHO & UNHCR, 2005) • A statement by Thoraya ... review, including Annelie Ginzel, Yahya Kane, Mahamat Koyalta, Danuta Lockett, Ahuka Longombe, Gwendolyn Lusi, Denis Mukwege, Sonia Navani, Manga Okenge (Pascal), Kate Ramsey, Peter Sikana, and Hategekimana...
- 33
- 841
- 0
Tài liệu ANTHROPOLOGY: AS A SCIENCE AND AS A BRANCH OF UNIVERSITY EDUCATION IN THE UNITED STATES pptx
... Races Theories of monogenism and polygenism Doctrine of “geographical provinces” or “areas of characterization.” The continental areas at the date of man’s appearance on the earth Eurafrica, Austafrica, ... user, provide a copy, a means of exporting a copy, or a means of obtaining a copy upon request, of the work in its original "Plain Vanilla ASCII" or other form Any alternate format must include the ... glazing; forms; decorative designs; painting and coloring Textile materials; ancient cloth and basket work; feather work Methods of making casts and models; taking squeezes, rubbings, copies, and...
- 28
- 665
- 0
Tài liệu Báo cáo khoa học: Mammalian Gup1, a homolog of Saccharomyces cerevisiae glycerol uptake/transporter 1, acts as a negative regulator for N-terminal palmitoylation of Sonic hedgehog doc
... (Promega, Madison, WT, USA) using the primers 5¢-CACACTACACTGGGAAGCAGAGACTCCAGC-3¢ and 5¢-AGCTGGCCCAGCAGCCATACACAGTTAAAG3¢ The cDNA was subcloned into the EcoRV site of pBluescript SK(+) (Stratagene, ... X-100 and CompleteTM protease inhibitor cocktail tablets (Roche Diagnostics, Indianapolis, IN, USA) Each sample was analyzed using a bicinchoninic acid protein assay kit (Pierce, Rockford, IL, USA), ... buffer, and the eluted samples were subjected to western blot analysis as described above The authors thank Drs Masato Yasui, Sadakazu Aiso and Masaaki Matsuoka for support; Dr Andrew P McMahon for...
- 14
- 499
- 0
Tài liệu Báo cáo khoa học: Peroxiredoxin II functions as a signal terminator for H2O2-activated phospholipase D1 doc
... generation of PA H2O2 can participate in many signaling pathways, including both pro-apoptotic and anti-apoptotic ones PrxII is proposed here to function as a signal terminator, eliminating H2O2 ... physiological rather than an artifact of lysis These results also support, using a visual rather than molecular biochemical approach, the proposal that PMA triggers increased interaction between PLD1 and ... as a PMA-promoted PLD1-interacting protein HA-tagged PLD1 was induced in the CHO cells, and affinity pull-down performed before and after 10 of 100 nm PMA stimulation In brief, the resting stage...
- 9
- 401
- 0
Tài liệu BÁO CÁO " LIPID PRODUCTION FROM MICROALGAE AS A PROMISING CANDIDATE FOR BIODIESEL PRODUCTION " ppt
... that increasing CO2 concentration of up to 1% of air will increase lipid produced by algae was given in Table As shown in this table, cell concentration obtained after 20 days incubation was ... extracted The effect of drying temperature was investigated in this study Gas chromatography analysis Sample was dissolved in ethyl acetate and 0.5 µL of this was injected into a Shimadzu GC-1 7A ... several days The fact that C vulgaris can survive at wide range of pH from to above was beneficial in considering of applying the algae in any conditions such as very low pH under direct flue gas...
- 5
- 396
- 1
Tài liệu BÁO CÁO " LIPID PRODUCTION FROM MICROALGAE AS A PROMISING CANDIDATE FOR BIODIESEL PRODUCTION " docx
... that increasing CO2 concentration of up to 1% of air will increase lipid produced by algae was given in Table As shown in this table, cell concentration obtained after 20 days incubation was ... extracted The effect of drying temperature was investigated in this study Gas chromatography analysis Sample was dissolved in ethyl acetate and 0.5 µL of this was injected into a Shimadzu GC-1 7A ... several days The fact that C vulgaris can survive at wide range of pH from to above was beneficial in considering of applying the algae in any conditions such as very low pH under direct flue gas...
- 5
- 345
- 0
Báo cáo khoa học: Subcellular compartmentalization of FADD as a new level of regulation in death receptor signaling pdf
... z-IETD (caspase-8 selective), z-VAD (a general caspase inhibitor) or z-DEVD (caspase-3 selective) did not affect ligand-mediated CD95 internalization at 15 and had moderate effects at 30 as compared ... cytoplasm is independent of CD95 receptor internalization, DISC assembly at endosomes and caspase activation, our data indicate that CD95 triggering induces additional, plasma membrane proximal ... signals at the plasma membrane that lead to the translocation of nuclear FADD to the cytoplasm In a process that depends on a positive feedback loop involving caspase8 activation, cytoplasmic FADD...
- 10
- 483
- 0
Báo cáo Y học: Protein methylation as a marker of aspartate damage in glucose-6-phosphate dehydrogenase-deficient erythrocytes docx
... [7], are cytoskeletal components, such as ankyrin and bands 4.1 and 4.2, as well as the integral membrane protein band (AE1; the anion transporter) [6] In this respect, asparaginyl deamidation has ... number of abnormal aspartate residues, spontaneously arising from L-asparaginyl deamidation and/or L-aspartyl isomerization reactions [7] In addition it has been reported that isoaspartate residues, ... esterification of membrane proteins in intact erythrocytes (in situ assay) Every day at least one patient and one control sample was processed in parallel When oxidative stress was applied, control and...
- 8
- 412
- 0
Báo cáo khoa học: Zinc-binding property of the major yolk protein in the sea urchin ) implications of its role as a zinc transporter for gametogenesis ppt
... data), as would zinc Zinc accumulation in females, however, should progress faster than that in males, as the ovary contains about twice as much zinc as the testis at stage 1, just before gametogenesis ... (Bio-Rad, Hercules, CA, USA) with bovine c-globulin as a standard Thyroglobulin (669 kDa), catalase (232 kDa), BSA (67 kDa) and chymotrypsinogen (25 kDa) were used for molecular mass estimation in ... zinc, indicating that the proteins binding zinc in these fractions scarcely contained any aromatic amino acid residues This suggests that the proteins are metallothioneins, well-known zinc-binding...
- 14
- 442
- 0
Báo cáo khoa học: Structure, epitope mapping, and docking simulation of a gibberellin mimic peptide as a peptidyl mimotope for a hydrophobic ligand pot
... restraints In the second stage, the same protocol was applied by adding hydrogen bond restraints and dihedral angle restraints Additional NOE constraints were added in each round of calculations, ... restraints, and eight dihedral angle restraints Fifty conformations that give low conformation energy and that give no distance and dihedral angle violations greater than ˚ ˚ 0.5 A and A, respectively, ... Gibberellin mimics peptide-antibody recognition 11 Murata T, Fushinobu S, Nakajima M, Asami O, Sassa T, Wakagi T & Yamaguchi I (2002) Crystal structure of the liganded anti-gibberellin A4 antibody...
- 11
- 565
- 0
Báo cáo Y học: Mydj2 as a potent partner of hsc70 in mammalian cells doc
... population (Fig 2A) , which was abundant in all tissues examined except skeletal muscle In contrast large dj2 mRNA was found to be abundant mainly in the brain, kidney and lung (Fig 2A) The major ... Nucleotide sequence analysis revealed that 5aI clone had a single open reading frame of 397 amino-acids beginning with the ATG codon at nucleotide 36–38 and terminating with the TAG codon at nucleotide ... large dj2 mRNA species, was subcloned to pBL-SK plasmid at EcoRI site In order to bacterially express Mydj2 the corresponding cDNA was amplified by PCR using primer I (5¢-GCA GTAGAGGATCCTGAAAGAAA-3¢)...
- 8
- 468
- 0
Báo cáo khoa học: "DATR AS A LEXICAL COMPONENT FOR PATR" pot
... to relate DATR and PATR so that the hierarchically structured lexical information in DATR can be made available in PATR-usable feature structures 4.1 A DATR-PATR INTERFACE The first idea that one ... is involved, but global inheritance plays a crucial role in one of the later examples Variables constitute an additional device available in DATR but are assumed to have the status of abbreviations ... the information about the bar level can be queried separately As a declarative language, DATR is independent of the procedural evaluation strategies embodied in particular DATR-implementations...
- 6
- 388
- 0
Báo cáo khoa học: Fatty acid omega-oxidation as a rescue pathway for fatty acid oxidation disorders in humans pot
... carnitine palmitoyltransferase I, mitochondrial carnitine acylcarnitine translocase and carnitine palmitoyltransferase II [5–7] In case of the straight-chain and 2-methyl-branched chain FAs, b-oxidation ... oxidation Beta-oxidation is the preferred way of oxidizing FAs In principle, each FA can be b-oxidized, including straight- and branched-chain FAs, as well as monoand polyunsaturated FAs There is ... saturated long-chain FAs These include very long-chain acylCoA dehydrogenase, medium-chain acyl-CoA dehydrogenase and short-chain acyl-CoA dehydrogenase The same is true for the third step in...
- 13
- 475
- 0
Báo cáo khoa học: Combining theoretical analysis and experimental data generation reveals IRF9 as a crucial factor for accelerating interferon a-induced early antiviral signalling pdf
... concentrations result in earlier maximal pathway activation and an increase in signal amplitude [3,4] Furthermore, alterations in the activity of a kinase or phosphatase may affect the speed of signalling ... signalling pathway activated by type I IFN is the JAK ⁄ STAT pathway The Janus kinases JAK1 and tyrosine kinase (TYK2) are activated in response to ligand binding to the receptor, and these kinases ... using an RNeasy Plus Mini Kit (Qiagen, Hilden, Germany) The RNA was used for the quantitative real-time PCR and microarray analysis To generate cDNA, lg of total RNA was transcribed using a QuantiTect...
- 14
- 432
- 0
Báo cáo khoa học: Distribution of the extrinsic proteins as a potential marker for the evolution of photosynthetic oxygen-evolving photosystem II ppt
... Chloroplast DNA Bacillariophyceae (diatoms) Thalassiosira pseudonana Nuclear DNA Chloroplast DNA Odontella sinensis Chloroplast DNA Prasinophyceae Mesostigma viride Chloroplast DNA Euglenophyceae ... thylakoid membranes isolated from Cheaeotoceros gracilis (A) , Pavlova gyrans (B), Laminria japonica (C) and Undaria pinnatifida (D) with antibodies raised against various extrinsic proteins Lane ... algae (L japonica and U pinnatifida) in the red lineage reacted with antibody against red algal PsbQ¢ but not with antibody against green algal and higher plant PsbQ (Fig 3) This indicates that...
- 11
- 501
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008