be a block head and an xref man
Báo cáo khoa học: A structured RNA in hepatitis B virus post-transcriptional regulatory element represses alternative splicing in a sequence-independent and position-dependent manner pot
Ngày tải lên :
28/03/2014, 23:20
... unspliced pgRNA and the SP1 splicing variant of HBV, primers SP1 (tgcccctatcctatcaacac), SP2 (actcccataggaattttccgaaa) and U2 (ttccaatgaggattaaagacag) were used Quantification of the splicing ratio by ... analysis of the fragments of the 5¢ end labeled and folded PRE-ISS wild-type RNA, which was cleaved by RNase T1, RNase V1 and RNase A The T1 seq and A seq lanes represent RNase T1 and RNase A ... The sense strand is highly CU rich (70.5%) and contains many single-stranded regions, whereas the antisense strand is complementarily GA rich and contains various GA-rich single-stranded regions...
- 14
- 379
- 0
Tài liệu Báo cáo khoa học: The plasminogen activator inhibitor 2 transcript is destabilized via a multi-component 3¢ UTR localized adenylate and uridylate-rich instability element in an analogous manner to cytokines and oncogenes pdf
Ngày tải lên :
16/02/2014, 09:20
... AGTAAGGAAAATAAGCTTGGGCATGATCCC GCTCACTGCCTAAGCTTTGTAGCTAATAAAG CTTTATTAGCTACAAAGCTTAGGCAGTGAGC CTTTGTTATTTATTATGCATTCCTATGGTGAGTT AACTCACCATAGGAATGCATAATAAATAACAAAG CTTTGTTAAAGCTTATGCATTCCTATGGTGAGTT AACTCACCATAGGAATGCATAAGCTTTAACAAAG ... SJS170 ALS030 SJS209 SJS275 SJS276 CGGAAGATCTAACTAAGCGTGCTGCTTC TACGAGATCTGTTGTTTGGAAGCAGGTT CGGAAGATCTGGGATCATGCCCATTTAG TACGAGATCTTAGCTACATTAAATAGGC GGGATCATGCCCAAGCTTATTTTCCTTACT AGTAAGGAAAATAAGCTTGGGCATGATCCC ... AACTCACCATAGGAATGCATAAGCTTTAACAAAG CCTCTTACACTTGCTTTTGAC GCAAAGGTGCCTTTGAGGTTG GACCCCTTCATTGACCTCAACTA CTTGATTTTGGAGGGATCTC TTAGCTACATTAAATAGGCAG GtaatacgactcactataGGGATCATGCCCATTTAG Forward (nt 1281–1298...
- 14
- 635
- 0
Báo cáo y học: "Lithium alters brain activation in bipolar disorder in a task- and state-dependent manner: an fMRI study" ppt
Ngày tải lên :
08/08/2014, 21:20
... Bipolar Clinic at the University of Alberta and by referral from colleagues A full personal and family history was obtained and diagnosis was made using Diagnostic and Statistical Manual of Mental ... stimulus termination Statistical analysis The mean BOLD signal magnitude in each task was calculated over all the ROIs (for that task) and an analysis of variance (ANOVA) was used to detect between ... therapy for bipolar disorder: systematic review and meta-analysis of randomized controlled trials Am J Psychiatry 2004, 161:217-2 American Psychiatric Association: Diagnostic and statistical manual...
- 7
- 367
- 0
Báo cáo y học: "Henoch-Schönlein purpura in an older man presenting as rectal bleeding and IgA mesangioproliferative glomerulonephritis: a case report" ppt
Ngày tải lên :
10/08/2014, 23:22
... with gastrointestinal bleeding may mislead physicians to the wrong diagnosis and management We report a case of Henoch-Schönlein purpura in an older man that presented as rectal bleeding and acute ... The C-reactive protein was slightly elevated at 1.3 Additional blood tests included anti-nuclear antibody (ANA), cryoglobulins, hepatitis B and C antibodies, antidouble stranded DNA antibodies, ... C3 and trace basement membrane staining with antibodies to IgM With these clinical and laboratory results he was diagnosed with a case of adult onset HSP and was initially treated with intravenous...
- 5
- 322
- 0
Báo cáo y học: " Oedema of the metatarsal heads II-IV and forefoot pain as an unusual manifestation of Lyme disease: a case report" ppsx
Ngày tải lên :
11/08/2014, 10:23
... localised, early disseminated, and late disease Figure and scantissue swelling MRI soft of the right foot – oedema of the metatarsal head MRI scan of the right foot – oedema of the metatarsal head and ... radiographs Right – Checking radiographs after weeks Early localised disease is seen days to weeks after a tick bite, and is characterized by ECM Fever, headache, malaise, myalgias, and arthralgias ... to have foot pain He was not taking any medication except for the NSAIDs, and had no known allergies Likewise, his family history was unremarkable, and he had a normal social history Gait analysis...
- 3
- 311
- 0
Báo cáo khoa học: "A Medical Emergency Team syndromes and an approach to their management" ppsx
Ngày tải lên :
12/08/2014, 23:21
... the management of MET calls and provides an educational framework for the management of acutely unwell ward patients Further evaluation and validation of the approach are required Key messages ... plan has been established, the members of the MET are encouraged to explain the cause of the call and subsequent management and follow-up plan to the medical and nursing staff, the patient and/ or ... the management of the patient; and third, always remain calm and concentrate on the management of the patient Management of the 'hypoxic/tachypnoeic MET call' Using the framework of the acronym...
- 4
- 258
- 0
ENHANCING THE EFFICIENCY OF THE QUALITY MANAGAMENT SYSTEM BY IMPROVING MANAGEMENT RESPONSIBILITY AND HUMAN RESOURCE MANAGEMENT AT VIET A PLASTIC AND COMPOSITE COMPANY
Ngày tải lên :
18/04/2013, 17:09
... A plastic and composite company in terms of management responsibility and human resource management Viet A plastic and composite company, a company of designing, manufacturing and trading plastic ... policy, and quality objectives 2.3 Human Resource Management Good human resource management is essential to retain staff and maintain a high overall level of quality management system performance ... carrying out and maintaining efficiency of quality management system Improving management responsibility and human resource management can bring many benefits for the company such as: enhancing efficiency...
- 33
- 933
- 5
Tài liệu Module 3: Designing a Software Distribution and Management Strategy ppt
Ngày tải lên :
10/12/2013, 15:15
... company’s Change and Configuration Management infrastructure Software Distribution and Management Goals You have been asked to create a plan for the organization’s software distribution and management ... Configuration Management infrastructure Software Distribution and Management Goals You have been asked to create a plan for the organization’s software distribution and management strategy To ... this lab, you will be able to: Determine an organization’s needs for software distribution and management Design a software distribution and management plan based on the needs of an organization...
- 40
- 533
- 0
Structural and semantic features of english idioms referring to head and a contrastive analysis with vietnamese idioms
Ngày tải lên :
20/12/2013, 18:33
... effective and interesting way because they contain not only the literal meanings but the figurative and expressive meanings as well They are an integral part of a language and they make the language ... example: with a high hand (in a haughty way) This idiom cannot be shortened in any circumstances, we also cannot say with a tall hand although high and tall are similar In contrast, a proverb is ... by an amount of water or steam in a confined space For example: They kept up a good head of steam 16 (in place names) a headland For example: Beach head 17 A main division in a lecture, an essay,...
- 54
- 1.8K
- 13
Tài liệu How to be a Programmer: A Short, Comprehensive, and Personal Summary ppt
Ngày tải lên :
21/12/2013, 20:15
... understanding of them and they syntax and meaning of SQL Team Skills 2.1 How to Manage Development Time To manage development time, maintain a concise and up-to-date project plan A project plan is an ... standardized core SQL is the lingua franca of relational databases You may or may not work in any field that can benefit from an understanding of relational databases, but you should have a basic ... is a very powerful and rich data query and manipulation language that is not quite a programming language It has many variations, typically quite product-dependent, which are less important than...
- 58
- 486
- 0
Tìm hiểu về an ninh mạng và kỹ thuật tấn công trojan and backdoor
Ngày tải lên :
28/12/2013, 20:49
... tính nạn nhân An ninh mạng Trang 15 Đề tài: Tìm hiểu An ninh mạng kỹ thuật công Trojan and Backdoor Hình 2.7 Command shell Trojan 2.7.2 Email Trojans • Attacker điều khiển tự xa máy tính nạn ... PHÓ VỚI TROJAN AND BACKDOOR 19 An ninh mạng Trang Đề tài: Tìm hiểu An ninh mạng kỹ thuật công Trojan and Backdoor 5.9.1 Biện pháp đối phó với Trojan 19 5.9.2 Biện pháp đối phó với Backdoor 20 ... hướng đến trang không rõ • Trình Anti-Virus bị vô hiệu h a thuộc tính không hoạt động An ninh mạng Trang 12 Đề tài: Tìm hiểu An ninh mạng kỹ thuật công Trojan and Backdoor • Thanh Taskbar biến •...
- 26
- 1.7K
- 4
Đồ án tìm hiểu về an ninh mạng và kỹ thuật tấn công trojan and backdoor
Ngày tải lên :
30/12/2013, 15:42
... TROJAN ĐƯỢC TRIỂN KHAI NHƯ THẾ NÀO .15 2.6 SỰ LÂY NHIỄM C A TROJAN VÀO HỆ THỐNG C A NẠN NHÂN .15 2.7 PHÂN LOẠI TROJAN .16 2.7.1 Command shell Trojan 16 2.7.2 Email Trojans ... nhân Hình 2.7 Command shell Trojan Pha ̣m Minh Tuấ n – M12CQCT01B Tìm hiểu An ninh mạng 2.7.2 Email Trojans • Attacker điều khiển tự xa máy tính nạn nhân cách gửi email • Attacker lấy file thư ... Netstat an CMD Pha ̣m Minh Tuấ n – M12CQCT01B Tìm hiểu An ninh mạng 2.5 TROJAN ĐƯỢC TRIỂN KHAI NHƯ THẾ NÀO • Tạo Trojan sử dụng Trojan house Construction Kit • Tạo Trojan, phần gói Trojanized...
- 29
- 2.6K
- 10
Tài liệu How to be a Programmer: A Short, Comprehensive, and Personal Summary pptx
Ngày tải lên :
18/01/2014, 06:20
... understanding of them and they syntax and meaning of SQL Team Skills 2.1 How to Manage Development Time To manage development time, maintain a concise and up-to-date project plan A project plan is an ... standardized core SQL is the lingua franca of relational databases You may or may not work in any field that can benefit from an understanding of relational databases, but you should have a basic ... is a very powerful and rich data query and manipulation language that is not quite a programming language It has many variations, typically quite product-dependent, which are less important than...
- 58
- 460
- 0
Tài liệu Step-by-Step Guide for Creating and Testing Connection Manager Profiles in a Test Lab doc
Ngày tải lên :
27/01/2014, 15:20
... server, and create a dial-up Connection Manager profile Install Connection Manager Administration Kit (CMAK) Click Start, point to Control Panel, and click Add or Remove Programs Click Add/Remove ... click Management and Monitoring Tools, and click Details Select the Connection Manager Administration Kit check box (as shown in the following figure), and install CMAK Install Phone Book Administrator ... Paper 22 Click Apply, and then click Next A command prompt window will open and close as the profile is created When the Completing the Connection Manager Administration Kit Wizard page appears...
- 59
- 1.1K
- 0
Tài liệu Characterization of the Polymorphic Behavior of an Organic Compound Using a Dynamic Thermal and X-ray Powder Diffraction Technique pptx
Ngày tải lên :
14/02/2014, 03:20
... David Albers,‡ Michelle Galgoci,† Dan King,‡ Daniel Miller,† Robert Newman,*,‡ Linda Peerey,‡ Eva Tai,† and Richard Wolf† Dowpharma Department, The Dow Chemical Company, 1710 Building, and Department ... thermogravimetric analysis (TGA), attenuated total reflectance (ATR) IR and ATR-near-IR),12 methotrexate (along with TGA),13 carbamazepine (along with FTIR and hot-stage FTIR thermomicroscopy),14 ranitidine ... performed at 52% and 100% relative humidity (RH) indicated that Form I formed a heptahydrate at typical laboratory temperatures and quickly became anhydrous above approximately 60–80 °C in a dry atmosphere...
- 16
- 549
- 0
Tài liệu Diagnosis and management of head and neck cancer docx
Ngày tải lên :
14/02/2014, 22:20
... standard of care Standards of care are determined on the basis of all clinical data available for an individual case and are subject to change as scientific knowledge and technology advance and patterns ... diagnosis and management of head and neck cancer 12 Hypopharyngeal cancer 12.1 Early HYPOPHARYNGEAL CANCER (Stage I and II) Early hypopharyngeal cancer is uncommon The majority of patients have ... or greater extracapsular lymph node spread 23 diagnosis and management of head and neck cancer For patients with advanced head and neck cancer, where postoperative radiotherapy is indicated,...
- 96
- 554
- 0
Tài liệu Báo cáo khoa học: Modeling of tRNA-assisted mechanism of Arg activation based on a structure of Arg-tRNA synthetase, tRNA, and an ATP analog (ANP) ppt
Ngày tải lên :
18/02/2014, 11:20
... codon usages for AGA and AGG codons are 19 and 34, respectively, and they amount to 98% among six codons for Arg The D-loops of isoacceptor tRNAUCU and tRNACCU contain nine (AGCAGGAC20aA) and 10 ... the a- NH2 group of Arg and the main chain C@O of Ser127 and ˚ O of the side chain of Asn129 are set at 3.15 A and ˚ , and the distances between the guanidinium 3.04 A moiety and the side chain ... Konno et al However, it was reported that, in the aminoacylation reaction, the kcat and Km values for tRNAArgICG and tRNAArgUCU on the Asn106 fi Ala, Phe109 fi Ala and Gln111 fi Ala mutant proteins...
- 17
- 512
- 0
Tài liệu A Roadmap to Quality - An e-learning Manual for Implementing Total Quality Management doc
Ngày tải lên :
18/02/2014, 11:20
... Consultative Committee in Standards and Quality Standards Department, Agency for Industrial Science and Technology, MITI ASEAN/Japan Cooperation Program for Standardization and Total Quality Management ... Calzadilla-Sarmiento, then Project Manager, Quality, Standardization and Metrology Branch, UNIDO A Roadmap to Quality has been developed with valuable assistance and support provided by Japan's ... programme, known as the Japan/ASEAN Cooperation Programme for Standardization and Total Quality Management, aims to provide ASEAN countries with the tools and methodologies that will promote standardization...
- 380
- 623
- 0
Tài liệu Báo cáo khoa học: The SCO2299 gene from Streptomyces coelicolor A3(2) encodes a bifunctional enzyme consisting of an RNase H domain and an acid phosphatase domain pdf
Ngày tải lên :
19/02/2014, 18:20
... encode a bifunctional enzyme consisting of an RNase H domain and an APase domain The RNase H and APase activities of the full length SCO2299 protein depend on its N-terminal RNase H domain and C-terminal ... here is a bifunctional enzyme consisting of an RNase H domain and an APase domain, and it is a novel style in the Type RNase H family Experimental procedures Cells, plasmids, and materials The ... Mori and T Baba (Institute for Advanced Biosciences, Keio University, Yamagata, Japan) Details on these strains in ASKA (a complete set of E coli K-12 ORF archive) library are available at http://ecoli...
- 10
- 561
- 1
Tài liệu Making the Right Moves A Practical Guide to Scientifıc Management for Postdocs and New Faculty doc
Ngày tải lên :
21/02/2014, 12:20
... Laura Bonetta, Ph.D Managing Editor: Patricia Davenport Production Manager: Dean Trackman Designer: Raw Sienna Digital Writers: Joan Guberman, Judith Saks, Barbara Shapiro, and Marion Torchia ... leading, motivating, and managing members of a lab “Mentoring and Being Mentored” explores what it means to be a mentor, particularly as a strategy for facilitating learning and training new scientists ... and obtained additional resources for the writers and course organizers HHMI’s Dean Trackman managed the production process; Cay Butler, Linda Harteker, and Kathleen Savory provided additional...
- 267
- 616
- 0