bax cytochrome c caspase 3 nadph oxidase 1 nox 1 nox 2 inducible nitric oxide synthase inos and endothelial e nos

Báo cáo sinh học: "Combination of cyclosporine and erythropoietin improves brain infarct size and neurological function in rats after ischemic stroke" potx

Báo cáo sinh học: "Combination of cyclosporine and erythropoietin improves brain infarct size and neurological function in rats after ischemic stroke" potx

Ngày tải lên : 18/06/2014, 22:20
... ischemia: MRI Yuen et al Journal of Translational Medicine 2 011 , 9 :14 1 http://www.translational-medicine.com/content/9 /1/ 1 41 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 study of acute ... with epifluorescence (Olympus IX-40) Western Blot Analysis for Bax, Cytochrome C, Caspase 3, NADPH oxidase (NOX -1) , NOX- 2, Inducible Nitric Oxide Synthase (iNOS) , and Endothelial (e) NOS Equal amounts ... interests Received: 15 June 2 011 Accepted: 24 August 2 011 Published: 24 August 2 011 References Hankey GJ: Stroke: how large a public health problem, and how can the neurologist help? Arch Neurol 19 99,...
  • 14
  • 475
  • 0
báo cáo hóa học:" Airborne particulate matter PM2.5 from Mexico City affects the generation of reactive oxygen species by blood neutrophils from asthmatics: an in vitro approach" docx

báo cáo hóa học:" Airborne particulate matter PM2.5 from Mexico City affects the generation of reactive oxygen species by blood neutrophils from asthmatics: an in vitro approach" docx

Ngày tải lên : 20/06/2014, 00:20
... 0/6 Age 43. 5 ± 6 .3 49.4 ± 11 .5 0 .14 22 BMI 26 .3 ± 3. 4 29 .6 ± 2. 2 0.07 21 FVC% 95.0 ± 12 .2 90.4 ± 18 .2 0.5407 FEV1% 99.4 ± 12 .3 83. 6 ± 21 . 5 0.07 02 FEF25–75% 11 2. 9 ± 23 . 9 54 .11 ± 23 . 2 0.00 02 Gender ... suspension and recorded the CL response over 10 minutes Particle Characteristics PM values measured at the CENICA site were 73 and 32 mg/m3 for PM10 and PM2.5, respectively The 24 hours average concentration ... its content Moreover, the presence of metallic elements such as iron and copper was detected, the former reached the higher percent in cluster and irregular, both in the fine and PM10 fractions;...
  • 11
  • 511
  • 0
báo cáo khoa học: " Differential patterns of reactive oxygen species and antioxidative mechanisms during atrazine injury and sucrose-induced tolerance in Arabidopsis thaliana plantlets" ppsx

báo cáo khoa học: " Differential patterns of reactive oxygen species and antioxidative mechanisms during atrazine injury and sucrose-induced tolerance in Arabidopsis thaliana plantlets" ppsx

Ngày tải lên : 12/08/2014, 03:20
... photosynthetic inhibition of Cyclotella Page 16 of 18 (page number not for citation purposes) BMC Plant Biology 20 09, 9 :28 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 meneghiniana (Bacillariophyta) ... (At3g10 920 ) and FSD3 (At5g 23 3 10 ) genes, which, respectively, encode mitochondrial and chloroplastic superoxide dismutases, were not differentially expressed in the presence of sucrose Exogenous ... after the release of singlet oxygen in Arabidopsis Plant Cell 20 03, 15 (10 ): 23 2 0- 23 3 2 Jimenez A, Hernandez JA, delRio LA, Sevilla F: Evidence for the presence of the ascorbate-glutathione cycle in...
  • 18
  • 265
  • 0
Báo cáo khoa học: Antioxidant defences and homeostasis of reactive oxygen species in different human mitochondrial DNA-depleted cell lines pot

Báo cáo khoa học: Antioxidant defences and homeostasis of reactive oxygen species in different human mitochondrial DNA-depleted cell lines pot

Ngày tải lên : 16/03/2014, 18:20
... need less Homeostasis of ROS in q0 cells (Eur J Biochem 2 71) 36 53 Ó FEBS 20 04 ρ+ 1 03 10 4 10 1 10 2 FL1-H 1 03 10 4 10 1 10 2 1 03 10 4 1 03 10 4 10 1 10 2 FL1-H 1 03 10 4 10 1 10 2 FL1-H 1 03 10 4 60 40 Counts 20 ... Chem 27 6, 21 9 95– 21 9 98 21 Vaux, E .C. , Metzen, E. , Yeates, K.M & Ratcli e, P.J (20 01) Regulation of hypoxia -inducible factor is preserved in the absence 22 23 24 25 26 27 28 29 30 31 32 33 34 35 ... sense 5¢-GCGACGAAG Ó FEBS 20 04 GCCGTGTGCGTGC -3 , antisense 5¢-ACTTTCTTCATT TCCACCTTTGCC -3 ; MnSOD [40], sense 5¢-CTTCA GCCTGCACTGAAGTTCAAT -3 , antisense 5¢-CTGAA GGTAGTAAGCGTGCTCCC -3 ; 36 B4, sense...
  • 11
  • 412
  • 0
Báo cáo y học: " Reduced levels of reactive oxygen species correlate with inhibition of apoptosis, rise in thioredoxin expression and increased bovine leukemia virus proviral loads" potx

Báo cáo y học: " Reduced levels of reactive oxygen species correlate with inhibition of apoptosis, rise in thioredoxin expression and increased bovine leukemia virus proviral loads" potx

Ngày tải lên : 12/08/2014, 23:22
... uninfected and BLV-infected B The balance between beneficial and deleterious effects of ROS is believed to be critical for cell survival and is achieved by a mechanism called "redox homeostasis" ... Cancer Research UK Your research papers will be: available free of charge to the entire biomedical community peer reviewed and published immediately upon acceptance cited in PubMed and archived ... and control sheep were cultivated for 24 h in absence or presence of the free radical scavenger Nacetyl-L-cysteine (NAC) added h prior VPA treatment (1 mM) Cells isolated from BLV-infected and control...
  • 10
  • 328
  • 0
Báo cáo y học: "Rheumatoid peripheral blood phagocytes are primed for activation but have impaired Fc-mediated generation of reactive oxygen specie" pptx

Báo cáo y học: "Rheumatoid peripheral blood phagocytes are primed for activation but have impaired Fc-mediated generation of reactive oxygen specie" pptx

Ngày tải lên : 09/08/2014, 10:20
... Diclofenac M 53 93 36 10 .3 417 10 .5 8.4 1. 5 Methotrexate M 78 57 74 12 .4 422 7.8 5.5 1. 5 - M 62 16 17 14 .1 20 7 6 .1 3. 5 - F 61 37 - 12 .3 2 61 6 .1 3. 9 1. 6 Leflunomide F 75 61 77 11 .6 24 6 6.5 5 .3 ... non-fluorescent and cell-permeable probe localises to the mitochondria, where it is converted into cationic DHR -1 23 It detects superoxide by reacting with hydrogen peroxide and/ or peroxynitrite [ 42, 43] ... CD14 expression and lymphocytes were negative for CD14 expression Expression of the receptors was correlated with the clinical measurements of disease made in the clinic, such as CRP, ESR and cell...
  • 11
  • 587
  • 0
báo cáo khoa học: " Reactive oxygen species and transcript analysis upon excess light treatment in wild-type Arabidopsis thaliana vs a photosensitive mutant lacking zeaxanthin and lutein" pps

báo cáo khoa học: " Reactive oxygen species and transcript analysis upon excess light treatment in wild-type Arabidopsis thaliana vs a photosensitive mutant lacking zeaxanthin and lutein" pps

Ngày tải lên : 11/08/2014, 11:22
... expressed protein -1, 20 26 75 91_ at AT2G39705 expressed protein -1, 20 25 7856_at AT3G 12 930 expressed protein -1, 20 2 6 32 64_at 24 9 929 _at AT2G38 810 AT5G2 23 4 0 histone H2A expressed protein -1, 19 -1, 18 26 6 32 9_at ... octicosapeptide/Phox/Bem1p (PB1) -1, 24 -1, 24 26 5457_at AT2G46550 expressed protein -1, 23 24 94 72_ at AT5G39 21 0 expressed protein -1, 23 25 2 13 6 _at AT3G50770 calmodulin-related protein -1, 21 25 2 922 _at AT4G39040 expressed ... amidotransferase -1, 12 2486 63_ at AT5G48590 expressed protein -1, 12 245984_at AT5G 13 0 90 expressed protein -1, 12 2506 63_ at AT5G0 711 0 prenylated rab acceptor (PRA1) -1, 11 25 4 011 _at 2 61 439 _at AT4G2 637 0 AT1G2 839 5...
  • 22
  • 475
  • 0
Báo cáo khoa học: Muramyl-dipeptide-induced mitochondrial proton leak in macrophages is associated with upregulation of uncoupling protein 2 and the production of reactive oxygen and reactive nitrogen species docx

Báo cáo khoa học: Muramyl-dipeptide-induced mitochondrial proton leak in macrophages is associated with upregulation of uncoupling protein 2 and the production of reactive oxygen and reactive nitrogen species docx

Ngày tải lên : 05/03/2014, 23:20
... unstimulated cells State State FCCP rate B 10 0 10 1 PI 10 2 1 03 A 10 4 MB (10 0 lgÆmL )1) 10 0 ± 11 2 ± 14 .2 10 7 ± 10 .8 95.68 ± 4.6 LPS (1 lgÆmL )1) 10 0 ± 1. 5 10 2 ± 12 .3 98 ± 7.6 98 .27 ± 8 .2 10 0 10 1 10 2 1 03 ... The percentage of decrease in cell viability (C) is the mean ± SEM of three independent experiments was noted between stimulated and MDP-treated samples in the percentage of apoptotic or necrotic ... uncoupling effect induced by these molecules with the level and function of UCP2 and free radical production in macrophages We find that MDP induces reactive oxygen and nitrogen species production and...
  • 11
  • 430
  • 0
Báo cáo khoa học: Structure, regulation and evolution of Nox-family NADPH oxidases that produce reactive oxygen species pptx

Báo cáo khoa học: Structure, regulation and evolution of Nox-family NADPH oxidases that produce reactive oxygen species pptx

Ngày tải lên : 16/03/2014, 06:20
... p67phox-binding region in p47phox are indicated below the sequence The three Ser residues Ser3 03, Ser 310 and Ser 328 directly interact with residues in the bis-SH3 domain (Gle2 41, Glu 21 1 , and Arg267, respectively) ... named NoxSH3 -1 and NoxSH3 -2, contain 627 and 630 amino acids, respectively The amino acid sequences of NoxSH3 -1 and NoxSH3 -2 are shown: the heme-coordinated His residues in transmembrane segment ... distributed in species that have Nox2 , including the choanoflagellate Mo brevicollis and the cnidarian Ne vectensis The known exceptions are the leech Capitella species (the Annelida) and the sea urchin...
  • 29
  • 618
  • 0
Báo cáo y học: "Reactive oxygen species induce expression of vascular endothelial growth factor in chondrocytes and human articular cartilage explants" pps

Báo cáo y học: "Reactive oxygen species induce expression of vascular endothelial growth factor in chondrocytes and human articular cartilage explants" pps

Ngày tải lên : 09/08/2014, 08:23
... 4 -2, Pu 21 4 /3- 2 and Pu 21 4 /5 -2) MG's research was funded by a grant from the National Institutes of Health (R 01- AG 220 21 ) References 10 11 12 13 14 15 16 Competing interests The authors declare that ... (Figure 1) ) The VEGF splice variants VEGF - 12 1 and VEGF -16 5 are detectable by splice-variant RT-PCR To determine whether the splice variants VEGF - 12 1 ( 526 bp) and VEGF -16 5 (658 bp) are expressed ... Henrotin Y: Reactive oxygen species downregu- Page of (page number not for citation purposes) Arthritis Research & Therapy 19 20 21 22 23 24 25 26 27 28 29 30 31 Vol No Fay et al late the expression...
  • 8
  • 332
  • 0
Bone Metabolism: The Role of STAT3 and Reactive Oxygen Species

Bone Metabolism: The Role of STAT3 and Reactive Oxygen Species

Ngày tải lên : 24/08/2014, 12:59
... sites and excises exons 18 -20 of STAT3, exons 17 and 21 are joined with a loxP site in between; exons 18 -20 circularize, and contain the other loxP site in between exons 18 and 20 These mice were ... for 12 0 cycles at hertz, for three consecutive days, using an electromagnetic actuator (Bose ElectroForce 32 00 series; EnduraTEC) The procedure was performed under general anesthesia, using 3- 5% ... located between two loxP sites These loxP sites are recognized by the Cre recombinase when the two lines of mice are bred together, thus excising the gene of interest The cell-specific promoter...
  • 73
  • 255
  • 0
Báo cáo y học: " Helicobacter pylori induces mitochondrial DNA mutation and reactive oxygen species level in AGS cells"

Báo cáo y học: " Helicobacter pylori induces mitochondrial DNA mutation and reactive oxygen species level in AGS cells"

Ngày tải lên : 25/10/2012, 11:18
... CCCGGACGTCTAAACCAAACC AATTACCCCCATACTCCTTACACT CCTCGGAGCTGGTAAAAA ACTACCCCGATGCATACACCACA GCCGTACGCCTAACCGCTAACA CGCACGGACTACAACCACGAC Reverse primer (5’ 3 ) GATGCTTGCATGTGTAATCT GGGGATCAATAGAGGGGGAAATA GGGTCATGGGCTGGGTTTTACTAT ... 7 73 82 trol 11 638 M 807±86 11 638 750±82a Duration (h) 12 24 14 82 1 53 14 27 16 2 15 64 16 4 14 74± 13 9 15 71 17 2 13 7 8 14 8 16 23 17 5 15 68 15 1 816 ± 93 848±80 759± 73 754± 71 7 03 72 415 37 b 485± 53 359±4 5c 32 2 41 ... 795± 71 control Hp 11 638 M 658± 62 586±54 415 37 30 3 35 18 6± 21 Hp 11 638 5 03 54a 35 0±42b 28 2 3 1c 1 53 17 d 10 2 12 e Hp 11 638 70 Hp 11 638 M Cytochrome C reduction 60 50 40 30 Note: P
  • 12
  • 557
  • 2
Báo cáo khoa học: Neuroglobin and cytoglobin expression in mice Evidence for a correlation with reactive oxygen species scavenging doc

Báo cáo khoa học: Neuroglobin and cytoglobin expression in mice Evidence for a correlation with reactive oxygen species scavenging doc

Ngày tải lên : 23/03/2014, 09:21
... reoxygenation In heart, muscle and liver, the H2O2 level dropped after 24 h of reoxygenation The correlation between ROS detection and protein level was studied in second order As can be seen ... for Each PCR reaction, including the nontemplate control, was performed in triplicate VEGF and Mb were used as positive control genes Several housekeeping genes were tested to choose the best ... the mean ± SEM was calculated Fluorescence changes from the cells were converted to pmol released H2O2 using a standard curve (0 20 0 pmol) We thank unknown referees for valuable comments We would...
  • 6
  • 391
  • 0
Báo cáo khoa học: Is there more to aging than mitochondrial DNA and reactive oxygen species? pot

Báo cáo khoa học: Is there more to aging than mitochondrial DNA and reactive oxygen species? pot

Ngày tải lên : 29/03/2014, 22:21
... 20 09 The Author Journal compilation ª 20 09 FEBS M F Alexeyev 10 0 10 1 10 2 1 03 10 4 10 5 10 6 10 7 10 8 10 9 11 0 11 1 11 2 1 13 sites takes place by single-nucleotide insertion and long-patch DNA synthesis ... cycling Biosci Rep 17 , 33 – 42 52 Gardner PR & Fridovich I (19 91) Superoxide sensitivity of the Escherichia coli aconitase J Biol Chem 26 6, 1 9 32 8 1 933 3 53 Liochev SI & Fridovich I (20 07) The effects ... enjoyed almost universal acceptance However, recent years have seen an abundance of experimental evidence that contradicts the MTA in its present form This article critically reviews the evidence...
  • 20
  • 523
  • 0
Báo cáo Y học: Inactivation of the Na+-translocating NADH:ubiquinone oxidoreductase from Vibrio alginolyticus by reactive oxygen species pot

Báo cáo Y học: Inactivation of the Na+-translocating NADH:ubiquinone oxidoreductase from Vibrio alginolyticus by reactive oxygen species pot

Ngày tải lên : 31/03/2014, 21:21
... fumarate reductase that unlike succinate dehydrogenase cannot be completely reduced by succinate [17 ] As a consequence, an increase in signal intensity of the reduced center I of fumarate reductase ... 26 4, 26 72 26 77 13 Neese, F., Zumft, W.G., Antholine, W .E & Kroneck, P.M.H (19 96) The purple mixed-valence CuA center in nitrous oxide 14 15 16 17 18 19 20 reductase: EPR of the copper- 63- , copper-65-, ... methosulfate [ 12 ] Visible spectra of membranes were recorded on a Shimadzu UV -30 00 spectrophotometer in the difference spectrum mode X-band EPR spectra were obtained with a Bruker ESP300 spectrometer with...
  • 6
  • 307
  • 0
báo cáo khoa học: "Reactive oxygen species-mediated apoptosis contributes to chemosensitization effect of saikosaponins on cisplatin-induced cytotoxicity in cancer cells" pdf

báo cáo khoa học: "Reactive oxygen species-mediated apoptosis contributes to chemosensitization effect of saikosaponins on cisplatin-induced cytotoxicity in cancer cells" pdf

Ngày tải lên : 10/08/2014, 10:20
... neck cancer cells by PUMA Molecular cancer therapeutics 20 07, 6 ( 12 Pt 1) : 31 80-8 Wang et al Journal of Experimental & Clinical Cancer Research 2 010 , 29 :15 9 http://www.jeccr.com/content /29 /1/ 159 ... human hepatoma cell lines Cancer letters 20 04, 2 13 ( 2) :2 13 - 21 Chen JC, Chang NW, Chung JG, Chen KC: Saikosaponin-A induces apoptotic mechanism in human breast MDA-MB- 2 31 and MCF-7 cancer cells The ... Wang et al Journal of Experimental & Clinical Cancer Research 2 010 , 29 :15 9 http://www.jeccr.com/content /29 /1/ 159 the molecular mechanisms by which saikosaponins exert their anti-cancer effect are...
  • 8
  • 395
  • 0
Báo cáo y học: " Early The tripeptide feG regulates the production of intracellular reactive oxygen species by neutrophils" pps

Báo cáo y học: " Early The tripeptide feG regulates the production of intracellular reactive oxygen species by neutrophils" pps

Ngày tải lên : 11/08/2014, 08:21
... CD11b /c CD49d Figure Cell Surface Expression of CD11b /c and CD49d Cell Surface Expression of CD11b /c and CD49d The effect of antigen challenge on the expression of CD11b /c β 2integrin and CD49d β 1- integrin ... Nurse, Cancer Research UK Your research papers will be: available free of charge to the entire biomedical community peer reviewed and published immediately upon acceptance cited in PubMed and archived ... leukocytes reflects a 6-fold increase in the number of circulating neutrophils (Figure 1c) feG treatment reduced the increase in the percentage of neutrophils to 29 ± 3% , which reflects a decrease...
  • 9
  • 214
  • 0
Báo cáo khoa học: "A Reactive oxygen species: toxic molecules or spark of life" docx

Báo cáo khoa học: "A Reactive oxygen species: toxic molecules or spark of life" docx

Ngày tải lên : 12/08/2014, 23:21
... for citation purposes) 13 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 A, Spies C: N-acetylcysteine increases liver blood flow and improves liver function in septic shock patients: Results ... http://ccforum.com/content /10 /1/ 20 8 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 oxide synthase generates superoxide and nitric oxide in arginine-depleted cells leading to peroxynitrite-mediated ... Critical Care Vol 10 No Magder magnetic fields, which makes them more reactive Substances that have unpaired electrons and are capable of independent existence are called free radicals By...
  • 8
  • 226
  • 0
Báo cáo y học: "Endogenous TGF-β activation by reactive oxygen species is key to Foxp3 induction in TCR-stimulated and HIV-1-infected human CD4+CD25- T cells" docx

Báo cáo y học: "Endogenous TGF-β activation by reactive oxygen species is key to Foxp3 induction in TCR-stimulated and HIV-1-infected human CD4+CD25- T cells" docx

Ngày tải lên : 13/08/2014, 05:22
... T regulatory cells Nat Immunol 20 03, 4 :33 7 -34 2 Page 15 of 16 (page number not for citation purposes) Retrovirology 20 07, 4:57 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 ... (more than 20 0-fold decrease), whereas exogenous TGF-β further enhanced TCR-induced Foxp3 expression (6- and 3. 5-fold increase compared to αCD3 and aCD3+αCD28 treated cells respectively) The effect ... (eBioscience, CA) Detection of ROS in T cells The reactive oxygen species (ROS) in T cells was detected as previously described(Chen et al, 20 01) The cells were resuspended in ml of colorless DMEM...
  • 16
  • 250
  • 0