ban hành kèm theo quyết định số 44 2006 qđ bgtvt ngày 19 12 2006

How to make your classroom more dynamic

How to make your classroom more dynamic

Ngày tải lên : 13/06/2015, 02:00
... of Professional ELT Development British Council, Thailand For VTTN Conference 8th – 9th December 2006 What is this? Destroy the order! Increasing interaction • Ask five people… – How long they...
  • 35
  • 365
  • 0
Contributions of Various Noncovalent Bonds to the Interaction between an Amide and S-Containing Molecules

Contributions of Various Noncovalent Bonds to the Interaction between an Amide and S-Containing Molecules

Ngày tải lên : 16/12/2012, 15:21
... Grabowski, J Phys Chem A 2011, 115, 127 89 127 99 [12] A Karpfen, A J Thakkar, J Chem Phys 2006, 124 , 224313 [13] N G Mirkin, S Krimm, J Phys Chem B 2008, 112, 15267 15268 [14] S M LaPointe, ... Scheiner, S J Grabowski, T Kar, J Phys Chem A 2001, 105, 10607 10 612 [8] E S Kryachko, S Scheiner, J Phys Chem A 2008, 112, 194 0 194 5 [9] B J van der Veken, S N Delanoye, B Michielsen, W A Herrebout, ... Sano, A Kakehi, K Iizuka, M Shiro, J Am Chem Soc 199 8, 120 , 3104 3110 [33] C Bleiholder, D B Werz, H Koppel, R Gleiter, J Am Chem Soc 2006, 128 , 2666 2674 [34] R Gleiter, D B Werz, B J Rausch,...
  • 7
  • 450
  • 0
Conceptualizing the interaction of class and gender

Conceptualizing the interaction of class and gender

Ngày tải lên : 01/11/2013, 07:20
... Humphries 197 7; Hartman 197 9; Barrett 198 4; Lewis 198 5) In contrast to Brenner and Ramas's argument that the family wage was in the interests of both male Interaction of class and gender 121 Particular ... insist that Marxist concepts and theory attempt to explain everything Shelton and Agger (199 3: 36), for example, write, ``Marxism is not simply a theory of class but a theory of everything, including ... towards sociological materialism, see Wright, Levine and Sober (199 2: ch 5) Interaction of class and gender 119 research and theory construction Five forms of possible class/gender interconnections...
  • 10
  • 394
  • 0
Tài liệu Module 1: Setup Changes pdf

Tài liệu Module 1: Setup Changes pdf

Ngày tải lên : 11/12/2013, 14:15
... Printed: 7/24/2003 12: 55 PM Module 1: Setup Changes 43 C:\WINDOWS\Microsoft.NET\Framework\v1.1.4322\Temporary ASP.NET Files) Last Saved: 7/24/2003 1:55 AM Last Printed: 7/24/2003 12: 55 PM 44 Module 1: ... 7/24/2003 1:55 AM Last Printed: 7/24/2003 12: 55 PM Admins running setup must be able to add/remo ve machine accounts from group Module 1: Setup Changes 19 File System Permissions Modified During ... assume that msExchDomainLocalGroupGuid was {1E 5192 85-D987-42C8-BE358DC57F85F270} Convert the GUIDs from string to Hex format In the above example, {1E 5192 85-D987-42C8-BE35-8DC57F85F270} becomes \85\92\51\1E\87\D9\C8\42\BE\35\8D\C5\7F\85\F2\70...
  • 78
  • 379
  • 0
Tài liệu Module 1: Setup Changes pptx

Tài liệu Module 1: Setup Changes pptx

Ngày tải lên : 18/01/2014, 05:20
... Printed: 7/24/2003 12: 55 PM Module 1: Setup Changes 43 C:\WINDOWS\Microsoft.NET\Framework\v1.1.4322\Temporary ASP.NET Files) Last Saved: 7/24/2003 1:55 AM Last Printed: 7/24/2003 12: 55 PM 44 Module 1: ... 7/24/2003 1:55 AM Last Printed: 7/24/2003 12: 55 PM Admins running setup must be able to add/remo ve machine accounts from group Module 1: Setup Changes 19 File System Permissions Modified During ... assume that msExchDomainLocalGroupGuid was {1E 5192 85-D987-42C8-BE358DC57F85F270} Convert the GUIDs from string to Hex format In the above example, {1E 5192 85-D987-42C8-BE35-8DC57F85F270} becomes \85\92\51\1E\87\D9\C8\42\BE\35\8D\C5\7F\85\F2\70...
  • 78
  • 364
  • 0
Tài liệu Báo cáo khoa học: Characterization of the interaction between the plasma membrane H+-ATPase of Arabidopsis thaliana and a novel interactor (PPI1) doc

Tài liệu Báo cáo khoa học: Characterization of the interaction between the plasma membrane H+-ATPase of Arabidopsis thaliana and a novel interactor (PPI1) doc

Ngày tải lên : 19/02/2014, 07:20
... Hagemann K (199 7) Topology and target interaction of the fusicoccin-binding 14-3-3 homologs of Commelina communis Plant J 12, 441 –453 14 Olivari C, Meanti C, De Michelis MI & Rasi-Caldogno F (199 8) ... regulation of H+-ATPase in plant plasma membrane Planta 211, 446 448 19 Chelysheva VV, Smolenskaya IN, Trofimova M, Babakov AV & Muromtsev GS (199 9) Role of 14-3-3 proteins in the regulation of H+-ATPase ... plasma membrane H+-ATPase Plant Physiol 122 , 463–470 16 Svennelid F, Olsson A, Piotrowski M, Rosenquist M, Ottman C, Larsson C, Oecking C & Sommarin M (199 9) Phosphorylation of Thr-948 at the...
  • 8
  • 629
  • 0
Tài liệu Báo cáo khoa học: Delineation of exoenzyme S residues that mediate the interaction with 14-3-3 and its biological activity ppt

Tài liệu Báo cáo khoa học: Delineation of exoenzyme S residues that mediate the interaction with 14-3-3 and its biological activity ppt

Ngày tải lên : 19/02/2014, 08:20
... Amersham S419QGLLDALDL428 M419AAAA428 S419QGLLDAAAA428 S419QGLLAAAAA428 S419QGLLAALAL428 I419QGLLDALDL428 S419AGLLDALDL428 S419QALLDALDL428 S419QGALDALDL428 S419QGLADALDL428 S419QGLLAALDL428 S419QGLLDKLDL428 ... S419QGLLDKLDL428 S419QGLLDAADL428 S419QGLLDALAL428 S419QGLLDALDA428 S419QGLLDAAAL428 [26] [14] This This This This This This This This This This This This This This FEBS Journal 273 (2006) 638–646 ª 2006 The ... of 14-3-3 proteins by phage display Biochemistry 38, 124 99 125 04 FEBS Journal 273 (2006) 638–646 ª 2006 The Authors Journal compilation ª 2006 FEBS 645 Delineation of ExoS residues L Yasmin et...
  • 9
  • 525
  • 0
Tài liệu Báo cáo khoa học: Insights into the interaction of human arginase II with substrate and manganese ions by site-directed mutagenesis and kinetic studies Alteration of substrate specificity by replacement of Asn149 with Asp docx

Tài liệu Báo cáo khoa học: Insights into the interaction of human arginase II with substrate and manganese ions by site-directed mutagenesis and kinetic studies Alteration of substrate specificity by replacement of Asn149 with Asp docx

Ngày tải lên : 20/02/2014, 02:21
... 395, 119 122 18 Morris SM, Bhamidipati D & Kepka-Lenhart D (199 7) Human type II arginase: sequence analysis and tissuespecific expression Gene 193 , 157–161 19 Perozich J, Hempel J & Morris SM (199 8) ... Archibald RM (194 5) Colorimetric determination of urea J Biol Chem 157, 507–518 Chinard FP (195 2) Photometric estimation of proline and ornithine J Biol Chem 199 , 91–95 Bradford MM (197 6) A rapid ... Reczkowski RS & Ash DE (199 4) Rat liver arginase: kinetic mechanism, alternate substrates Inhibitors, Arch Biochem Biophys 312, 31–37 Ho SN, Hunt HD, Horton RM, Pullen JK & Pease LR (198 9) Site-directed...
  • 9
  • 651
  • 0
Tài liệu Báo cáo Y học: Role of electrostatics in the interaction between plastocyanin and photosystem I of the cyanobacterium Phormidium laminosum ppt

Tài liệu Báo cáo Y học: Role of electrostatics in the interaction between plastocyanin and photosystem I of the cyanobacterium Phormidium laminosum ppt

Ngày tải lên : 21/02/2014, 01:21
... (kJÆmol)1) DHàa (kJÆmol)1) DSàa (JÆmol)1ÆK)1) Wild-type D44A K53A R93A R93Q R93E 7.1 12. 1 7.8 3.3 4.1 1.3 10.6 10.9 12. 4 5.9 7.0 8.5 10.0 11.7 12. 3 7.6 6.7 3.4 34.06 32.66 33.74 36.00 35.45 38.37 ... Bendall, D.S (199 6) The role of acidic residues of plastocyanin in its interaction with cytochrome f Biochim Biophys Acta 127 7, 115 126 Ubbink, M., Ejdeback, M., Karlsson, B.G & Bendall, D.S (199 8) ¨ ... Honig, B (199 4) Accurate calculation of hydration free energies using macroscopic solvent models J Phys Chem 98, 197 8 198 8 ¨ 33 Young, S., Sigfridsson, K., Olesen, K & Hansson, O (199 7) The involvement...
  • 10
  • 673
  • 0
Báo cáo khoa học: Definition of the residues required for the interaction between glycine-extended gastrin and transferrin in vitro pptx

Báo cáo khoa học: Definition of the residues required for the interaction between glycine-extended gastrin and transferrin in vitro pptx

Ngày tải lên : 07/03/2014, 02:20
... 160 140 120 100 80 60 40 20 12. 0 –6.0 220 200 180 160 140 120 100 80 60 40 20 12. 0 –6.0 220 200 180 160 140 120 100 80 60 40 20 12. 0 –6.0 Apo-transferrin –5.5 –5.0 –4.5 –4.0 Ggly concentration ... 140 120 100 80 60 40 20 WT Ggly no N Ggly no C Ggly + Mo Mo C+ N+ WT no no Mo Mo Relative density (%) B Relative density (%) C Relative density (%) D 220 200 180 160 140 120 100 80 60 40 20 12. 0 ... R et al (198 8) Molecular structure of serum transferrin at 3.3-A resolution Biochemistry 27, 5804–5 812 Wally J, Halbrooks PJ, Vonrhein C, Rould MA, Everse SJ, Mason AB & Buchanan SK (2006) The...
  • 9
  • 543
  • 0
Báo cáo khóa học: Disruption of the interaction between the Rieske iron–sulfur protein and cytochrome b in the yeast bc1 complex owing to a human disease-associated mutation within cytochrome b potx

Báo cáo khóa học: Disruption of the interaction between the Rieske iron–sulfur protein and cytochrome b in the yeast bc1 complex owing to a human disease-associated mutation within cytochrome b potx

Ngày tải lên : 07/03/2014, 15:20
... complex (Eur J Biochem 271) 129 3 Fig Location of the mutations in the cytochrome bc1 complex The figure was prepared using the coordinates of the yeast enzyme (Protein Data Bank accession code 1KYO) ... 5777–5782 Grivell, L.A (198 9) Nucleo–mitochondrial interactions in mitochondrial biogenesis Eur J Biochem 182, 477–493 Cruciat, C.-M., Hell, K., Folsch, H., Neupert, W & Stuart, R.A (199 9) ¨ Bcs1p, an ... Chretien, D., De Lonlay, P., Parfait, B., Munnich, A., Kachaner, J., Rustin, P & Rotig, A (199 9) ¨ 18 19 20 A mitochondrial cytochrome b mutation but no mutation of nuclearly encoded subunits...
  • 7
  • 498
  • 0
Báo cáo khoa học: Structural and functional analysis of the interaction of the AAA-peroxins Pex1p and Pex6p pptx

Báo cáo khoa học: Structural and functional analysis of the interaction of the AAA-peroxins Pex1p and Pex6p pptx

Ngày tải lên : 07/03/2014, 16:20
... GGGAACTTTTTTCGAAGTCGCTTAGTGCGTTTACACCAT CTCGTACGCTGCAGGTCGAC KU532 KU616 KU617 KU718 KU 719 KU1233 KU1234 KU1235 KU1236 KU1237 KU1009 KU1010 KU1011 KU1 012 KU1130 KU1131 KU1132 KU1133 fragments of pIB1 ⁄ (construct of ... & Slonimski PP (198 9) Birth of the D-E-A-D box Nature 337, 121 122 38 Hettema EH, Girzalsky W, van Den Berg M, Erdmann R & Distel B (2000) Saccharomyces cerevisiae Pex3p and Pex19p are required ... R & Rothman JE (199 4) N-ethymaleimidesensitive fusion protein: a trimeric ATPase whose hydrolysis of ATP is required for membrane fusion J Cell Biol 126 , 945–954 20 Beyer A (199 7) Sequence analysis...
  • 12
  • 584
  • 0
Báo cáo Y học: Inhibition of the SERCA Ca21 pumps by curcumin Curcumin putatively stabilizes the interaction between the nucleotide-binding and phosphorylation domains in the absence of ATP pot

Báo cáo Y học: Inhibition of the SERCA Ca21 pumps by curcumin Curcumin putatively stabilizes the interaction between the nucleotide-binding and phosphorylation domains in the absence of ATP pot

Ngày tải lên : 08/03/2014, 23:20
... 43 Pick, U (198 1) Interaction of fluorescein isothiocyanate with nucleotide-binding sites of the Ca-ATPase from sarcoplasmic reticulum Eur J Biochem 121 , 187 195 44 McIntosh, D.B (199 8) The ATP ... Michelangeli, F (199 4) Characterisation of a novel Ca2þ pump inhibitor (bis-phenol) and its effects on intracellular Ca2þ mobilization Biochim Biophys Acta 1195 , 252 –258 29 Coll, R.J & Murphy, A.J (199 1) ... Froud, R.J & Lee, A.G (198 6) Conformational transitions in the Ca2þ þ Mg2þ-activated ATPase and the binding of Ca2þ ions Biochem J 237, 197 –206 31 Mitidieri, F & de Meis, L (199 5) Ethanol has different...
  • 10
  • 594
  • 0
Báo cáo " Study on wave setup with the storm surge in Hai Phong coastal and estuarine region " pot

Báo cáo " Study on wave setup with the storm surge in Hai Phong coastal and estuarine region " pot

Ngày tải lên : 14/03/2014, 15:20
... calculated wave-setup in several storms effect on Hai Phong including: Kate (197 3), Vera (198 3), Fankie (199 6), Marty (199 6), Nikie (199 6) and Damrey (2005) Tables from to show the results of wave-setup ... 24/09/2005 13h, 24/09/2005 19h, 24/09/2005 7h, 25/09/2005 13h, 25/09/2005 19h, 25/09/2005 7h, 26/09/2005 13h, 26/09/2005 19h, 26/09/2005 7h, 27/09/2005 13h, 27/09/2005 19h, 27/09/2005 1.00 1.00 ... 112 111 108 124 Wave setup (cm) Hanslow & Nielsen 40.99 36.17 34.45 39.42 Gourlay 27.53 26.06 25 .44 28.04 Raubenh-eimer 22.61 21.58 20.94 24.80 Gourlay 40.38 41.47 40.72 48.07 Raubenh-eimer 19. 94...
  • 8
  • 435
  • 0
EUROPEAN COMPETITION LAW ANNUAL 2005: The Interaction between Competition Law and Intellectual Property Law doc

EUROPEAN COMPETITION LAW ANNUAL 2005: The Interaction between Competition Law and Intellectual Property Law doc

Ngày tải lên : 16/03/2014, 12:20
... Co., 448 U.S 176, 215 (198 0) 131 Dell Computer, 121 FTC 616 (199 6) 131, 277, 300 Diamond v Diehr, 450 U.S 175 (198 1) 121 , 124 Duplan Corp v Deering Milliken, Inc., 444 F ... ASCAP, 195 0 -195 1 CCH Trade Cases 62, 595 255, 344 United States v BMI, 194 0 -194 3 CCH Trade Cases 56,096 255, 344 United States v Colgate & Co., 250 U.S 300,307, 39 S.Ct 465 63 L.Ed.992 (191 9) ... Ofces of Curtis Trinko, 124 S.Ct 872 (2004) 192 0, 74, 11 112, 442 , 450, 452, 580 West Pub Co v Mead Data Cent., Inc., 799 F.2d 1 219 (8th Cir 198 6) 125 Winans v Denmead, 56...
  • 768
  • 844
  • 1
Báo cáo khoa học: Concerted mutation of Phe residues belonging to the b-dystroglycan ectodomain strongly inhibits the interaction with a-dystroglycan in vitro pot

Báo cáo khoa học: Concerted mutation of Phe residues belonging to the b-dystroglycan ectodomain strongly inhibits the interaction with a-dystroglycan in vitro pot

Ngày tải lên : 16/03/2014, 12:20
... 12 Bozic D, Sciandra F, Lamba D & Brancaccio A (2004) The structure of the N-terminal region of murine skeletal muscle a-dystroglycan discloses a modular architecture J Biol Chem 279, 448 12 448 16 ... single mutants b-DG(654–750)Phe692 fi Ala, b-DG(654– FEBS Journal 273 (2006) 4929–4943 ª 2006 The Authors Journal compilation ª 2006 FEBS 4931 Mutagenesis at the a–b dystroglycan interface M Bozzi ... acid stretch that is likely to be involved in the FEBS Journal 273 (2006) 4929–4943 ª 2006 The Authors Journal compilation ª 2006 FEBS M Bozzi et al Mutagenesis at the a–b dystroglycan interface...
  • 15
  • 337
  • 0
Báo cáo khoa học: Mapping of the interaction site of CP12 with glyceraldehyde-3-phosphate dehydrogenase from Chlamydomonas reinhardtii Functional consequences for glyceraldehyde-3-phosphate dehydrogenase pot

Báo cáo khoa học: Mapping of the interaction site of CP12 with glyceraldehyde-3-phosphate dehydrogenase from Chlamydomonas reinhardtii Functional consequences for glyceraldehyde-3-phosphate dehydrogenase pot

Ngày tải lên : 16/03/2014, 13:20
... of GAPDH and CP12 were calculated according to Eqns (1) and (2) Ligand Kd (nM) DGb (kcalÆmol)1) WT mut DGb À DGb (kcalÆmol)1) Wild-type CP12 E39A CP12 E39K CP12 D36A CP12 D36K CP12 0.4 13.6 30 ... GAPDH ⁄ CP12 complex The E39A ⁄ K and D36A CP12 mutants reconstitute the GAPDH ⁄ CP12 complex Although the FEBS Journal 273 (2006) 3358–3369 ª 2006 The Authors Journal compilation ª 2006 FEBS ... CP12 to thioredoxin in the GAPDH ⁄ CP12 complex is specifically due to the interaction of CP12 with GAPDH Impact of cysteine residues of CP12 on the reconstitution of the subcomplex GAPDH/CP12...
  • 12
  • 330
  • 0
Báo cáo khoa học: Calcium-induced contraction of sarcomeres changes the regulation of mitochondrial respiration in permeabilized cardiac cells doc

Báo cáo khoa học: Calcium-induced contraction of sarcomeres changes the regulation of mitochondrial respiration in permeabilized cardiac cells doc

Ngày tải lên : 16/03/2014, 22:20
... J Biol Chem 276, 2148221488 19 Balaban RS (2002) Cardiac energy metabolism homeostasis: role of cytosolic calcium J Mol Cell Cardiol 34, 125 9127 1 20 Korzeniewski B (199 8) Regulation of ATP supply ... heart Biochem J 128 , 147159 27 Balaban RS, Kantor HL, Katz LA & Briggs RW (198 6) Relation between work and phosphate metabolite in the in vivo paced mammalian heart Science 232, 1121 1123 28 Starling ... & Wrzosek A (199 8) Changes in force and cytosolic Ca2+ concentration after length changes in isolated rat ventricular trabeculae J Physiol 506, 43 1444 31 Allen DG & Kentish JC (198 5) The cellular...
  • 17
  • 241
  • 0
Báo cáo khoa học: Amino acid residues on the surface of soybean 4-kDa peptide involved in the interaction with its binding protein potx

Báo cáo khoa học: Amino acid residues on the surface of soybean 4-kDa peptide involved in the interaction with its binding protein potx

Ngày tải lên : 17/03/2014, 03:20
... 3.47 12. 00 102.00 2.85 333.00 927.00 0.333 38.90 108.00 C Polar to alanine variants N4A S8A H34A T36A 1 .44 2.01 3.02 4.73 14.30 13.80 19. 20 38.20 99.00 68.70 63.60 80.80 11.60 8.02 7.43 9 .44 D ... area of insulin consisting of ValA3, TyrA19, ValB12 and TyrB16 (Fig 7D,E,F) In the active state, insulin exposes the active area (ValA3, TyrA19, ValB12 and TyrB16) for entry into the insulin ... shown with arrows: BGG, bovine gamma globulin (158 kDa); OA, ovalbumin (44 kDa); MG, equine-myoglobin (17 kDa); VB12, vitamin B12 (1.35 kDa) Lines have been used in each chromatogram to separate...
  • 10
  • 420
  • 0