at the shell prompt in a terminal window type su and press return type the root password a

Báo cáo khoa học: Role of the C-terminal extension in a bacterial tyrosinase Michael Fairhead and Linda Thony-Meyer doc

Báo cáo khoa học: Role of the C-terminal extension in a bacterial tyrosinase Michael Fairhead and Linda Thony-Meyer doc

Ngày tải lên : 06/03/2014, 11:20
... 2,2-biquinoline was added The mixture was incubated for 10 at room temperature and A5 46 was measured, using water as a reference A standard curve using 0–165 lm CuCl2Æ2H2O was also made and gave a calculated ... pro-tyrosinase mutant carrying an alanine at this position, F45 3A Curiously, an increase in protein expression was obtained for this mutant tyrosinase similar to that obtained when the entire C -terminal extension ... Federal Laboratories for Materials Testing and Research Journal compilation ª 2010 FEBS M Fairhead and L Thony-Meyer ¨ The importance of Phe453 in pro-tyrosinase is also indicated by the fact that...
  • 13
  • 778
  • 0
Men''''s Health Huge in a Hurry: Get Bigger, Stronger, and Leaner in Record Time with the New Science of Strength Training_2 pptx

Men''''s Health Huge in a Hurry: Get Bigger, Stronger, and Leaner in Record Time with the New Science of Strength Training_2 pptx

Ngày tải lên : 14/03/2014, 23:20
... use a variety of hand fifth week Rather than taking the entire week positions-neutral (palms facing each other) off from training, you scale back the weights and overhand (palms down) as well as ... cautionary, and kind demanding than isolation exercises, breaking of commonsense Few of you will want to down more muscle tissue and requiring more the same exercises over and over again in the ... to include variations on pushups and rows to put more strain on the ligaments and tendons to hit the muscles you're targeting But as of your elbow joints than they can handle THEPLANS The easiest...
  • 112
  • 530
  • 1
Men''''s Health Huge in a Hurry: Get Bigger, Stronger, and Leaner in Record Time with the New Science of Strength Training_3 pot

Men''''s Health Huge in a Hurry: Get Bigger, Stronger, and Leaner in Record Time with the New Science of Strength Training_3 pot

Ngày tải lên : 14/03/2014, 23:20
... position and attach a straight bar, V handle, or rope Grab the bar, handle, or rope and step back so that your arms are straight and there's tension on the cable (The cable should be at a 45- to ... Get Lean , Phases lA and PREP: Load a barbell with the appropriate weight Grab the bar with an overhand grip that's just less than shoulder width Stand holding the barbell at arm's length in front ... seatedrow station) Attach the O-shaped handle to the cable Grab the handle with a neutral grip and sit on the bench with your feet against the supports, knees bent, and torso upright You want...
  • 98
  • 452
  • 1
Men''''s Health Huge in a Hurry: Get Bigger, Stronger, and Leaner in Record Time with the New Science of Strength Training_4 pptx

Men''''s Health Huge in a Hurry: Get Bigger, Stronger, and Leaner in Record Time with the New Science of Strength Training_4 pptx

Ngày tải lên : 22/03/2014, 16:21
... include bloating, diar- happens to be a naturally occurring trans fatty rhea, and gas I mean really, really, really bad acid, found in meat and cheese The ones you gas So avoid sugar alcohols, and get ... avocado to a salad ucts offer vitamins and minerals that you c As for saturated fat, you don't have to 320 won't find in the others To various degrees, WHATTOEATAND WHENTOEATIT those foods are ... men and women on a low-carb diet actually reduced their LDL more than a matched group on a low-fat diet This was despite the fact that the low-carb group ate a lot more saturated fat Another...
  • 57
  • 391
  • 1
Men''''s Health Huge in a Hurry: Get Bigger, Stronger, and Leaner in Record Time with the New Science of Strength Training_1 doc

Men''''s Health Huge in a Hurry: Get Bigger, Stronger, and Leaner in Record Time with the New Science of Strength Training_1 doc

Ngày tải lên : 22/03/2014, 16:21
... between a Move your hands closer together, and the great-looking body that's functional and well range of motion lengthens That gives your coordinated and a great-looking body that's arm muscles -the ... superhero appearance The connection between big pain and big What he's really doing, in all likelihood, is muscles seems obvious and inarguable, and the articles that accompany the photos rein- platform ... that aren't affiliated with T-Nation Those discussions can get heated, and some even turn vicious But I've been around long enough to realize that heat and hate always accompany a genuine paradigm...
  • 103
  • 552
  • 2
LORD NEUBERGER OF ABBOTSBURY, MASTER OF THE ROLLS JUSTICE IN A TIME OF ECONOMIC CRISIS AND IN THE AGE OF THE INTERNET ppt

LORD NEUBERGER OF ABBOTSBURY, MASTER OF THE ROLLS JUSTICE IN A TIME OF ECONOMIC CRISIS AND IN THE AGE OF THE INTERNET ppt

Ngày tải lên : 31/03/2014, 03:20
... development, of international law, international relations and the nation-state He said this, ‘It is a cliché that generals prepare to fight the last war rather than the next one, But if it is a cliché, ... last as long, but with the increase in the length of the average trial and the decrease in the length of the average marriage, we may be approaching a cross-over And a trial, whether criminal or ... important part today, and I am sure they will continue to play an equally important part in the development of the law in the future And, rather than dwelling on the past, I thought that I would...
  • 16
  • 468
  • 0
Báo cáo hóa học: "Early experiences on the feasibility, acceptability, and use of malaria rapid diagnostic tests at peripheral health centres in Uganda--insights into some barriers and facilitators" pdf

Báo cáo hóa học: "Early experiences on the feasibility, acceptability, and use of malaria rapid diagnostic tests at peripheral health centres in Uganda--insights into some barriers and facilitators" pdf

Ngày tải lên : 21/06/2014, 19:20
... evidence that was available at the time and agreed via consensus to go for a phased approach in deploying mRDTs to a national scale, and in a manner that complemented microscopy-based diagnosis ... to generate information for the thematic analysis informed by the conceptual framework All data collection tools were pretested at Kasangati HC IV, a health facility not participating in the study ... collaborated in the training and supervision of HWs CA coordinated the implementation of the study, and ZK led data quality control and analysis with CA CA and DK prepared the study report and CA wrote...
  • 34
  • 365
  • 0
báo cáo khoa học: "Primary retroperitoneal mucinous cystadenoma of borderline malignancy in a male patient. Case report and review of the literature" pdf

báo cáo khoa học: "Primary retroperitoneal mucinous cystadenoma of borderline malignancy in a male patient. Case report and review of the literature" pdf

Ngày tải lên : 09/08/2014, 02:21
... stain for keratine 8/18, keratine 20, pankeratine, CEA and Ki-67 (Figure 6, Figure 7) Two months later the patient had a new abdominal CT-scan which demonstrated absence of residual disease The ... mucin-containing atypical epithelial cells (Figure 5) The lining cells were stratified, generally to two or three layers, and the nuclear atypia was mild to moderate The collagen fibers of the wall ... disintegrated by pools of mucous, epithelial cells and calcifications Lymphocytic infiltration was also observed The PAS-D and Alcian Blue stain was positive as well as the immunihistochemical...
  • 5
  • 355
  • 0
Báo cáo y học: " Liposarcoma of the forearm in a man with type 1 neurofibromatosis: a case report" ppsx

Báo cáo y học: " Liposarcoma of the forearm in a man with type 1 neurofibromatosis: a case report" ppsx

Ngày tải lên : 11/08/2014, 17:21
... Authors’ contributions MDS, MYAS, SFW, JP and BFEZ all analyzed and interpreted the patient data regarding the NF1 and liposarcoma MDS carried out the operation on the patient and was the main ... complications Concerning the treatment, we recommend early intensive investigations and an interdisciplinary approach, such as a tumour board, regarding surgery, radiotherapy, chemotherapy and further ... taken intra-operatively after assuring that an R0 resection was possible The treatment was completed with postoperative radiotherapy Due to the large tumour size, histopathological findings and...
  • 5
  • 266
  • 0
Studies on the antibody repertoire in a dengue virus immune subject and isolation of neutralizing antibodies by phage display technology

Studies on the antibody repertoire in a dengue virus immune subject and isolation of neutralizing antibodies by phage display technology

Ngày tải lên : 13/10/2015, 16:41
... of capillary leakage, liver enlargement/ damage (indicated by elevation in the levels of liver enzymes aspartate aminotransferase and alanine aminotransferase), circulatory failure, accompanied ... a series of 10 EDIII-specific hybridomas as templates (including 9F12), a small chimeric Fab phage library was generated by Dr Nicole Moreland in the Vasudevan Laboratory The generation and amplification ... to each well, and the plate was incubated undisturbed at 40 37°C for 30min Following centrifugation at 4000g for 5min at 4°C, supernatant was removed and the cell pellets were resuspended in 500µL...
  • 122
  • 342
  • 0
Lipid profile variations in a group of healthy elderly and centenarians pptx

Lipid profile variations in a group of healthy elderly and centenarians pptx

Ngày tải lên : 22/03/2014, 14:20
... proteins and 25% fats (9% saturated fatty acids, 9% monosaturated fats, 7% polyunsaturated fats) We evaluated: body weight, height and Body Mass Index (BMI) us to verify the ability to move and to ... for paired data Activity Daily Living (ADL) and Instrumental Activity Daily Living (IADL) Results We administered to the patients ADL4 and IADL Lawton’s tests in order to evaluate their self-sufficiency ... the longevity, another main characteristic is represented by the body weight maintained within the normal range ADL and IADL tests suggest that nonagenarians and centenarians are the two groups...
  • 5
  • 448
  • 0
STUDY ON EPIDEMIOLOGICAL FEATURES, APPLICATION OF DIAGNOSTIC KIT FOR DETECTION OF TRYPANOSOMIASIS CAUSED BY TRYPANOSOMA EVANSI IN CATTLE AND BUFFALOES IN A FEW NORTHERN MOUNTAINOUS PROVINCES AND RECOMMENDATION FOR PREVENTIVE AND TREATMENT MEASURES

STUDY ON EPIDEMIOLOGICAL FEATURES, APPLICATION OF DIAGNOSTIC KIT FOR DETECTION OF TRYPANOSOMIASIS CAUSED BY TRYPANOSOMA EVANSI IN CATTLE AND BUFFALOES IN A FEW NORTHERN MOUNTAINOUS PROVINCES AND RECOMMENDATION FOR PREVENTIVE AND TREATMENT MEASURES

Ngày tải lên : 28/04/2014, 13:08
... effective and safe in treating trypanosomiasis in cattle and buffaloes 22 + Examination and treatment for trypanosomiasis in buffaloes and cattle infected with T evansi in summer and Autumn in order ... outbreak of trypanosomiasis and mortality rates of buffaloes and cattle in Winter and Spring Exterminating sucking flies and gad flies that transmit tripanosomiasis - Exterminating flies and gad ... (using trypamidium samorin) in treating trypanosomiasis in buffaloes and cattle During the treatment let the affected animals stay in their stable for - days and having good feeding ring and management...
  • 14
  • 590
  • 0
báo cáo hóa học: " Acute lead intoxication in a female battery worker: Diagnosis and management" ppt

báo cáo hóa học: " Acute lead intoxication in a female battery worker: Diagnosis and management" ppt

Ngày tải lên : 20/06/2014, 00:20
... biopsy was unrevealing and this finding does not support the presence of a hematological disorder as the cause of the anemia The patient received an oral chelating agent (Succimer) and an improvement ... unrelated to the absorption of lead Moreover, the laboratory finding of basophilic stippling in peripheral smear could also be seen in thalassaemia as an indication of a defect in protein synthesis ... protoporphyrin changes in lead intoxication: a case-report and review of the literature Occup Med (Lond) 2004, 54:587-91 14 Fonte R, Agosti A, Scafa F, Candura SM: Anaemia and abdominal pain due to...
  • 4
  • 347
  • 0
Báo cáo lâm nghiệp: "Paternity analysis of Populus nigra L. offspring in a Belgian plantation of native and exotic poplars" doc

Báo cáo lâm nghiệp: "Paternity analysis of Populus nigra L. offspring in a Belgian plantation of native and exotic poplars" doc

Ngày tải lên : 07/08/2014, 16:20
... nigra (0.44 ha) Moreover, the poplar plantation was located in an agricultural landscape in which there were many other hybrid poplar plantations composed of P × canadensis and P × interamericana ... populations may therefore be in danger of being lost through genetic assimilation [30] In the latter case, efforts should focus on maintaining and expanding the remaining non-hybrid native populations ... nigra cv Italica is located outside the study stand at a distance of about 500 m to the North The study plot is situated in an agricultural landscape in which there are many poplar plantations...
  • 8
  • 286
  • 0
Báo cáo khoa học: "Hybridization and mating system in a mixed stand of sessile and pedunculate oak" pptx

Báo cáo khoa học: "Hybridization and mating system in a mixed stand of sessile and pedunculate oak" pptx

Ngày tải lên : 08/08/2014, 19:21
... species be mantained? In this paper patterns of hybridization and of the mating system of Q petraea and Q robur have been inferred from examination of allozyme variation in cohorts of a stand comprised ... form a barrier to gene flow, but in the intermediate habitats the species are in contact and it is there that one can find the greatest number of intermediate forms (Grandjean and Sigaud, 1987) ... during the autumn of 1989, and germinated in an incubator Technical procedures and genetic interpretations are described in detail in Kremer et al (1991) and Zanetto et al (1993) We stained and then...
  • 6
  • 256
  • 0
Báo cáo y học: "Effect of a small molecule inhibitor of nuclear factor-κB nuclear translocation in a murine model of arthritis and cultured human synovial cells" pps

Báo cáo y học: "Effect of a small molecule inhibitor of nuclear factor-κB nuclear translocation in a murine model of arthritis and cultured human synovial cells" pps

Ngày tải lên : 09/08/2014, 07:20
... (5'-TGCACGATGCACCTGTACGA, 3'-AGGCCCAAGGCCACAGGTAT), IL-6 (5'-GTTCCTGCAGAAAAAGGCAAAG, 3'-CTGAGGTGCCCATGCTACATTT), matrix metalloproteinase (MMP)-3 (5'ATGGAGCTGCAAGGGGTGAG, 3'-CCCGTCACCTCCAATCCAAG), and ... well as swelling of the joints, and pathways controlling the proliferation of RA FLS include an NF-κB-dependent pathway [32] Representative data shown in Fig indicate that RA FLS incorporate a certain ... treated with DNase I (Takara, Ohtsu, Japan), and RT-PCR was carried out using OneStep RT-PCR Kit (Qiagen) and the following primers: β-actin (5'-GTCCTCTCCCAAGTCCACACA, 3'-CTGGTCTCAAGTCAGTGTACAGGTAA),...
  • 12
  • 459
  • 0
Báo cáo y học: "Cardiac surgery in a patient with retroperitoneal fibrosis and heart valvulopathy, both due to pergolide medication for Parkinson''''s disease" pps

Báo cáo y học: "Cardiac surgery in a patient with retroperitoneal fibrosis and heart valvulopathy, both due to pergolide medication for Parkinson''''s disease" pps

Ngày tải lên : 10/08/2014, 10:20
... epicardial pace maker are also seen All authors: have made substantial contributions to conception and design, or acquisition of data, or analysis and interpretation of data; have been involved in ... population studies comparing patients with Parkinson's disease and non-parkinsonian controls suggests that the risk of substantial valve regurgitation is 5-6 times higher in patients with Parkinson's ... period An x-ray performed during the early postoperative period The ureteral catheters are showing (white arrows) while the annulus of the mechanical valves (black arrow) and the wires of the epicardial...
  • 3
  • 308
  • 0
báo cáo khoa học: "Fatal septicemia in a patient with cerebral lymphoma and an Amplatzer septal occluder: a case report" pdf

báo cáo khoa học: "Fatal septicemia in a patient with cerebral lymphoma and an Amplatzer septal occluder: a case report" pdf

Ngày tải lên : 10/08/2014, 22:20
... manuscript All authors read and approved the final manuscript References Balasundaram RP, Anandaraja S, Juneja R, Choudhary SK: Infective endocarditis following implantation of Amplatzer atrial ... Fatal septicemia in a patient with cerebral lymphoma and an Amplatzer septal occluder: a case report Claudia Stöllberger1*, Adam Bastovansky1 and Josef Finsterer1,2 Addresses: 1Krankenanstalt ... further course was complicated by a non-Hodgkin lymphoma and probably by chemotherapyinduced Evans syndrome Symptomatic atrial fibrillation was diagnosed 58 months after implantation, and a therapy...
  • 10
  • 247
  • 0
báo cáo khoa học: "Lenalidomide induced good clinical response in a patient with multiple relapsed and refractory Hodgkin''''s lymphoma" pptx

báo cáo khoa học: "Lenalidomide induced good clinical response in a patient with multiple relapsed and refractory Hodgkin''''s lymphoma" pptx

Ngày tải lên : 10/08/2014, 22:21
... Lactate dehydrogenase (U/L) < 241 250 175 Aspartate aminotransferase (U/L) 8-30 20 16 Alanine aminotransferase (U/L) 10-36 16 Gamma-glutamyl transpeptidase (U/L) 9-35 15 10 Alkaline phosphatase ... Metabolic activity was detected in the lungs and abdominal lymph nodes The patient has remained on continuous lenalidomide since 2008 In a follow-up examination in August 2009 she was found to be in ... studies are needed to assess the clinical Table 1: Results of laboratory tests before initiation of lenalidomide treatment and after 12 months of continuous treatment Laboratory value White cell count...
  • 3
  • 285
  • 0
Báo cáo y học: "Hyperthyroidism from autoimmune thyroiditis in a man with type 1 diabetes mellitus: a case report" pdf

Báo cáo y học: "Hyperthyroidism from autoimmune thyroiditis in a man with type 1 diabetes mellitus: a case report" pdf

Ngày tải lên : 10/08/2014, 23:21
... prospectively, as many patients with this disease return to normal over time or develop hypothyroidism, as was the case in our patient An alternative approach to treating a patient such as the one described ... examination revealed a well-developed, well-nourished man in no apparent distress He had a normal blood pressure level of 130/80 mmHg, and his pulse was within the normal range at 72 beats/minute ... beats/minute There was no lid lag or proptosis His thyroid gland was not enlarged and was non-tender There was no cervical lymphadenopathy or appendicular tremor The remainder of his physical examination...
  • 4
  • 307
  • 0

Xem thêm