assume both alice and bob choose x y 9 we have the following situation with g 7 and p

Báo cáo Y học:Association of the thyrotropin receptor with calnexin, calreticulin and BiP Effects on the maturation of the receptor docx

Báo cáo Y học:Association of the thyrotropin receptor with calnexin, calreticulin and BiP Effects on the maturation of the receptor docx

Ngày tải lên : 31/03/2014, 08:20
... (Cx5) and 5% 2-mercaptoethanol were added to the supernatant and the samples were reduced by boiling for The samples were then run on 7. 5% SDS/PAGE After performing Western blotting on a poly(vinylidiene ... described by others [16], the use of MG132 unexpectedly blocks the formation of complex-type structures Interactions between TSHR and CNX, CRT, and BiP During and after their synthesis, glycoproteins ... [31,32], and cytoplasmic chaperones such as Hsp70 or Hsp90 can interact with the polypeptide chains during their synthesis and can bind to the cytoplasmic parts of transmembrane proteins [33] Further...
  • 8
  • 443
  • 0
Báo cáo y học: "Infiltration of the synovial membrane with macrophage subsets and polymorphonuclear cells reflects global disease activity in spondyloarthropathy" pps

Báo cáo y học: "Infiltration of the synovial membrane with macrophage subsets and polymorphonuclear cells reflects global disease activity in spondyloarthropathy" pps

Ngày tải lên : 09/08/2014, 06:22
... gp 39 peptide complex, recognized by mAb 12A Present or absent vascularity of the sublining layer, infiltration of the sublining layer, and the presence of lymphoid aggregates, plasma cells, and ... of specific macrophage subsets and polymorphonuclear leukocytes (PMNs) in SpA synovium compared with RA [2], and the strong and rapid reduction of synovial macrophages, T lymphocytes, and PMNs ... reflect specific phenotypes and/ or global disease activity in SpA R360 Materials and methods Patients and samples The study included 99 SpA patients fulfilling the criteria of the European Spondyloarthropathy...
  • 11
  • 398
  • 0
Báo cáo y học: "Association of the FCRL3 gene with rheumatoid arthritis: a further example of population specificity" ppsx

Báo cáo y học: "Association of the FCRL3 gene with rheumatoid arthritis: a further example of population specificity" ppsx

Ngày tải lên : 09/08/2014, 08:22
... of the PADI4 gene with RA also shows variation between populations and, like the FCRL3-1 69* C/T gene polymorphism, the susceptibility haplotype is common in all populations A functional haplotype ... these participants, 65.3% ( 690 /10 57) were female, 77 .2% (78 2/1013) were rheumatoid factor-positive, 79 . 7% (642/806) were erosive, and 20.4% (1 49/ 7 29) , 49. 1% (358 /7 29) and 30.5% (222/ 7 29) patients ... using the Pyrosequencing genotyping method according to manufacturer's instructions [12] Haplotype analysis Haplotypes were estimated using the EM algorithm implemented in HelixTree software (Golden...
  • 5
  • 406
  • 0
Báo cáo khoa học: "Acute stroke: we have the treatments and we have the evidence we need to use them" doc

Báo cáo khoa học: "Acute stroke: we have the treatments and we have the evidence we need to use them" doc

Ngày tải lên : 13/08/2014, 03:20
... implying that thrombolytic therapy should now be more widely used There is a long way to go; currently fewer than 5% of eligible patients in Europe receive thrombolytic therapy All stroke patients, ... terms of the European licence were studied, and so patients with any of the following were excluded: age greater than 80 years, severe stroke, anticoagulation, history of diabetes and previous ... infarction: The Seventh ACCP Conference on Antithrombotic and Thrombolytic Therapy Chest 2004, Suppl 3:5 49- 575 10 The National Institute of Neurological Disorders and Stroke rt-PA study group: Tissue plasminogen...
  • 3
  • 314
  • 0
Tài liệu Tự điển Food Science, Technology And Nutrition - Vần X,Y,Z doc

Tài liệu Tự điển Food Science, Technology And Nutrition - Vần X,Y,Z doc

Ngày tải lên : 26/01/2014, 12:20
... E212 Potassium benzoate E213 Calcium benzoate E214 Ethyl p- hydroxybenzoate E215 Sodium ethyl p- hydroxybenzoate E216 Propyl p- hydroxybenzoate E2 17 Sodium propyl p- hydroxybenzoate E218 Methyl p- hydroxybenzoate ... 20 90 11 30 90 15 Se I g g 1000 60 220 30 1300 70 290 45 70 0 890 90 0 90 0 90 0 90 0 70 0 890 90 0 90 0 90 0 90 0 200 220 340 440 Mg Fe Zn Cu mg mg mg g 100 30 – 275 75 11 460 80 500 130 10 P mg 1300 ... Karaya gum E4 17 Tara gum E418 Gellan gum E425 Konjac Polysorbates E432 Polyoxyethylene sorbitan monolaurate; Polysorbate 20 E433 Polyoxyethylene sorbitan mono-oleate; Polysorbate 80 E434 Polyoxyethylene...
  • 24
  • 394
  • 1
Báo cáo Y học: The plant S-adenosyl-L-methionine:Mg-protoporphyrin IX methyltransferase is located in both envelope and thylakoid chloroplast membranes pot

Báo cáo Y học: The plant S-adenosyl-L-methionine:Mg-protoporphyrin IX methyltransferase is located in both envelope and thylakoid chloroplast membranes pot

Ngày tải lên : 08/03/2014, 16:20
... (D161-protein), were prepared again by PCR ampli®cation with forward primer 5¢-AGGCATAT GTTGTTGCAGGCGGAGGAA-3¢ (80-NdeI) or forward primer 5¢-CTCCATATGCCACTTGCTAAGGAAG-3¢ (161±NdeI) coupled to ... Takamiya, K., Douce, R & Joyard, J ( 199 9) Biochemical and topological properties of type A MGDG synthase, a spinach chloroplast envelope enzyme catalyzing the synthesis of both prokaryotic and ... associate with the thylakoids, a transfer of Mg-protoporphyrin IX from the envelope to the thylakoids would be required to supply the thylakoid MgPIXMT with substrate Localization of MgPIXMT in the...
  • 9
  • 568
  • 0
Báo cáo Y học: Determinants of the inhibition of a Taiwan habu venom metalloproteinase by its endogenous inhibitors revealed by X-ray crystallography and synthetic inhibitor analogues pdf

Báo cáo Y học: Determinants of the inhibition of a Taiwan habu venom metalloproteinase by its endogenous inhibitors revealed by X-ray crystallography and synthetic inhibitor analogues pdf

Ngày tải lên : 08/03/2014, 23:20
... for the synthetic analogues of peptide inhibitors Subsitea Inhibitor Ki (·104 Wild-type pENW pEQW pEKW pEWN pEWK ENW pEDW pEAW pENF pENL pENA pENG pENLW pENWL 1.60 1. 69 1.24 2 29. 10 194 . 49 9.55 ... surrounding the hydrophobic substrate binding pocket are in yellow, while those locating at bottom are in green The possible hydrogen bonds are shown Both figures were prepared using GRASP The P) 2 and P) 3 ... plausible hydrogen bond is detected, though the pyro-ring nitrogen is near the amide oxygen of Asn1 07 The alkyl part of pyro-ring is oriented to contact with the hydrophobic side ˚ chain of Ile1 09 and...
  • 10
  • 475
  • 0
Báo cáo y học: "Synovial histopathology of psoriatic arthritis, both oligo- and polyarticular, resembles spondyloarthropathy more than it does rheumatoid arthritis" pot

Báo cáo y học: "Synovial histopathology of psoriatic arthritis, both oligo- and polyarticular, resembles spondyloarthropathy more than it does rheumatoid arthritis" pot

Ngày tải lên : 09/08/2014, 06:22
... (PsA) and nonpsoriatic spondyloarthropathy (ankylosing spondylitis [AS] + undifferentiated spondyloarthropathy [USpA]) Synovial biopsies from RA, PsA and spondyloarthropathy (SpA; AS/USpA) patients ... citrullinated proteins and MHC–HC gp 39 peptide complexes were not observed in PsA, whereas 44% of RA samples were positive for citrullinated proteins and 46% were positive for MHC–HC gp 39 peptide complexes ... citrullinated proteins and MHC–HC gp 39 peptide complexes were observed only in RA patients (44% positive for citrullinated proteins and 46% positive for MHC–HC gp 39 peptide complexes), with absence...
  • 12
  • 308
  • 0
Báo cáo y học: " A 1-year case-control study in patients with rheumatoid arthritis indicates prevention of loss of bone mineral density in both responders and nonresponders to infliximab" docx

Báo cáo y học: " A 1-year case-control study in patients with rheumatoid arthritis indicates prevention of loss of bone mineral density in both responders and nonresponders to infliximab" docx

Ngày tải lên : 09/08/2014, 10:20
... on biphosphonates At baseline, serum PTH and 25-OHD levels were 30.5 ± 17. 6 pg/ml and 19. 7 ± 10.3 ng/ml, respectively Serum osteocalcin and serum CTX-I were 19. 9 ± 11.8 ng/ml and 446 ± 3 07 pg/ml, ... every weeks combined with methotrexate (in accordance with the ATTRACT [Anti-TNF Therapy in RA with Concomitant Therapy] protocol [7] ) All of these patients were included in the study and followed ... to 46 ng/ml), C-terminal cross-linking telopeptide of type I collagen (CTX-I; 330 to 78 2 pg/ml) and parathyroid hormone (PTH; 15 to 65 pg/ml) were measured using an Elecsys 2010 (Roche Diagnostics,...
  • 7
  • 498
  • 0
Báo cáo y học: "Pre-clinical development as microbicide of zinc tetra-ascorbo-camphorate, a novel terpenoid derivative: Potent in vitro inhibitory activity against both R5- and X4-tropic HIV-1 strains without significant in vivo mucosal toxicity" docx

Báo cáo y học: "Pre-clinical development as microbicide of zinc tetra-ascorbo-camphorate, a novel terpenoid derivative: Potent in vitro inhibitory activity against both R5- and X4-tropic HIV-1 strains without significant in vivo mucosal toxicity" docx

Ngày tải lên : 10/08/2014, 05:21
... 5'GGCGCCACTGCTAGAGATTTT-3'; reverse: (5'-GCCTCAATAAAGCTTGCCTTGA-3') and exonuclease probe (5'FAM-AAGTAGTGTGTGCCCGTCTGTTRTKTGACTTAMRA-3') designed to amplify a fragment in the long terminal repeat (LTR) ... macrophages and DCs were more than 90 % pure Purification of autologous T lymphocytes T cells were subsequently prepared from the monocytedepleted cell fraction Peripheral blood lymphocytes (PBL) were ... instrument (Roche Applied Science), with using the sense primer NEC152 (GCCTCAATAAAGCTTGCCTTGA) and the reverse primer NEC131 (GGCGCCA CTGCTAGAGATTTT) in the presence of a dually (FAM and TAMRA) labelled...
  • 11
  • 480
  • 0
Báo cáo y học: "Structural and functional characterization of human apolipoprotein E 72-166 peptides in both aqueous and lipid environments" pot

Báo cáo y học: "Structural and functional characterization of human apolipoprotein E 72-166 peptides in both aqueous and lipid environments" pot

Ngày tải lên : 10/08/2014, 05:21
... 3-4 and 7 -9, apoE(-) mice serum incubated with full length apoE3 and apoE4, and with apoE2-, apoE3-, and apoE4- (72 -166) proteins, respectively The VLDL bands were shifted with the binding of apoE ... NdeI-XhoI pET-29a(+) fragment Expression and Purification of ApoE Proteins Protein induction and purification procedures have been described previously [22,23] Typical yields of the apoE (72 -166) proteins ... previously, we employed HepG2 cells as the LDLR carriers [22] H-LDL was used as the ligand and the apoE proteins with or without DMPC were therefore the competitors Overall, apoE-DMPC complex showed better...
  • 9
  • 333
  • 0
Báo cáo y học: "Cardiac surgery in a patient with retroperitoneal fibrosis and heart valvulopathy, both due to pergolide medication for Parkinson''''s disease" pps

Báo cáo y học: "Cardiac surgery in a patient with retroperitoneal fibrosis and heart valvulopathy, both due to pergolide medication for Parkinson''''s disease" pps

Ngày tải lên : 10/08/2014, 10:20
... declare that they have no competing interests Authors' contributions Figure An x- ray performed during the early postoperative period An x- ray performed during the early postoperative period The ureteral ... comparing 64 patients taking pergolide with 49 patients taking cabergoline, 42 patients taking a non-ergot derivative, and 90 control patients, and showed that the frequency of clinically Page of (page ... the past months His symptoms included exerciseinduced dyspnea and paroxysmal nocturnal dyspea (NYHA III) From his past medical history we noted Parkinson's disease diagnosed three years ago Pergolide...
  • 3
  • 308
  • 0
Báo cáo y học: " Severe refractory autoimmune hemolytic anemia with both warm and cold autoantibodies that responded completely to a single cycle of rituximab: a case report" pps

Báo cáo y học: " Severe refractory autoimmune hemolytic anemia with both warm and cold autoantibodies that responded completely to a single cycle of rituximab: a case report" pps

Ngày tải lên : 11/08/2014, 00:23
... bilateral lower-extremity pitting edema There was no significant peripheral lymphadenopathy, and there was no evidence of hypertension The complete blood count revealed anemia with a hemoglobin level ... agglutination, polychromasia, target cells and spherocytes were seen on a peripheral smear The direct Coombs test was positive for complement C3d and immunoglobulin G (IgG) antibody, which were ... immunodeficiency virus were ruled out Computed tomography (CT) of the chest, abdomen and pelvis was remarkable for hepatosplenomegaly Subsequently, the patient underwent a bone marrow biopsy that showed...
  • 5
  • 368
  • 0
Báo cáo y học: "Phosphodiesterase 5 inhibitors lower both portal and pulmonary pressure in portopulmonary hypertension: a case repor" pot

Báo cáo y học: "Phosphodiesterase 5 inhibitors lower both portal and pulmonary pressure in portopulmonary hypertension: a case repor" pot

Ngày tải lên : 11/08/2014, 10:22
... PAWP pulmonary arterial wedged pressure PAP pulmonary arterial pressure PAPmean mean pulmonary arterial pressure PAPsystolic systolic pulmonary arterial pressure PDE5 phosphodiesterase PPHTN portopulmonary ... idiopathic pulmonary hypertension (IPAH) have also been tested in PPHTN with promising results PDE5 inhibitors, a recently accepted therapy of IPAH [4], have been shown to lower PAP in PPHTN, ... pulmonary arterial pressure but may have exacerbated portal hypertension in a patient with cirrhosis and portopulmonary hypertension J Gastroenterol 2006, 41: 593 - 5 97 Finley DS, Lugo B, Ridgway J,...
  • 5
  • 443
  • 0
Báo cáo y học: " A three-year-old boy with X-linked adrenoleukodystrophy and congenital pulmonary adenomatoid malformation: a case report" doc

Báo cáo y học: " A three-year-old boy with X-linked adrenoleukodystrophy and congenital pulmonary adenomatoid malformation: a case report" doc

Ngày tải lên : 11/08/2014, 14:21
... this report, we describe a preschool boy who presented with intermittent symptoms of respiratory distress, lethargy, dehydration, hypoglycemia, hypotension, hyperpigmentation and large CPAM He ... developed seizures and neurologic symptoms and was diagnosed with X- ALD after further evaluation http://www.jmedicalcasereports.com/content/3/1 /93 29 lows: pH 7. 32, PaCO2 37. 1 mmHg, PaO2 86 mmHg, and ... pathological examination of the lung cysts showed multiple thinwalled cysts that ranged from 0.3 cm to 1.5 cm in diameter and filled with clear fluid The cysts appeared to occupy approximately 90 %...
  • 5
  • 260
  • 0
Báo cáo y học: " Elevated expression of both mRNA and protein levels of IL-17A in sputum of stable Cystic Fibrosis patients" potx

Báo cáo y học: " Elevated expression of both mRNA and protein levels of IL-17A in sputum of stable Cystic Fibrosis patients" potx

Ngày tải lên : 12/08/2014, 13:22
... primer: 5’ ttc atg ctg gct aag gag gc 3’; reverse primer: 5’ gca gcg ctc act cat act gac t; Taqman probe: 5’ TAM agc ttg gct gat aac aac aca gac gtt cgt TAMRA 3’) Primers and probes for IL-17A ... homozygous as in the other group this was only 11.8%, confirming previous data concerning the effect of genotype on lung disease severity and pulmonary infection status [26] The slightly higher expression ... processing, RT-PCR and CBA, drafted the manuscript AWW performed RNA isolation, cDNA synthesis and RT-PCR of sputum samples and gave technical support AK performed CBA analysis and helped with the problems...
  • 8
  • 288
  • 0
Báo cáo y học: " Real time analysis of b2-adrenoceptor-mediated signaling kinetics in Human Primary Airway Smooth Muscle Cells reveals both ligand and dose dependent differences" ppt

Báo cáo y học: " Real time analysis of b2-adrenoceptor-mediated signaling kinetics in Human Primary Airway Smooth Muscle Cells reveals both ligand and dose dependent differences" ppt

Ngày tải lên : 12/08/2014, 13:22
... The single polypeptide cytosolic probe utilised in these studies termed CFP-Epac(dDEP,CD)-VENUS, was produced by the Jalink group and has been described previously [10, 17] Figure 1A shows CFP ... in HEK 293 and CHO cells following exposure to both endogenous (epinephrine and norepinephrine) and synthetic (isoproterenol, fenoterol and terbutaline) ligands [ 29] This finding echoed previous ... cells were excited with a laser emitting at 440 nm and the emission of CFP and YFP were detected by rapid switching of 470 nm and 535 nm bandpass filters positioned in a filter wheel and the FRET...
  • 10
  • 309
  • 0
Báo cáo y học: "Both TRIM5α and TRIMCyp have only weak antiviral activity in canine D17 cells" ppsx

Báo cáo y học: "Both TRIM5α and TRIMCyp have only weak antiviral activity in canine D17 cells" ppsx

Ngày tải lên : 13/08/2014, 05:22
... sample were submitted to a 30-cycle PCR analysis using the following oligodeoxynucleotides: GFPs, 5'GACGACGGCAACTACAAGAC and GFPas, 5'-TCGTCCATGCCGAGAGTGAT PCR products were separated on a 2% agarose-TAE ... transfection mix included 10 g of pCL-Eco, g of pMD -G, and 10 g of the appropriate pMIP or pCLNCX construct To produce the N-MLVGFP and B-MLVGFP vectors, the transfection mix included 10 g of pCIG3 N ... pCIG3 N or B, g of pMD -G, and 10 g of pCNCG To produce the HIV-1GFP vector, cells were transfected with 10 g of p R8 .9, g of pMD -G, and 10 g of pTRIP-CMV-GFP http://www.retrovirology.com/content/4/1/68...
  • 11
  • 272
  • 0
Báo cáo y học: "Use of the measure your medical outcome profile (MYMOP2) and W-BQ12 (Well-Being) outcomes measures to evaluate chiropractic treatment: an observational study"

Báo cáo y học: "Use of the measure your medical outcome profile (MYMOP2) and W-BQ12 (Well-Being) outcomes measures to evaluate chiropractic treatment: an observational study"

Ngày tải lên : 25/10/2012, 10:06
... with the General Wellbeing (GWB) and Energy scales of the W-BQ12 The Wellbeing scale of the MYMOP2 had a strong negative correlation with the GWB, a moderate negative correlation with the PWB and ... negative well-being score is reversed and then added with the energy and positive well-being scores to produce a general well-being score (range: 0-36) The higher the score on this reliable and ... (physical or Polus et al Chiropractic & Manual Therapies 2011, 19: 7 http://chiromt.com/content/ 19/ 1 /7 Table Description of MYMOP2 subcategories Category Code Description Symptom S1 The symptom...
  • 8
  • 538
  • 0