... evaluations In the PROWESS trial, plasma samples were obtained at baseline (day of randomization) and daily through to study day A central laboratory (Covance Central Laboratory Services, Indianapolis, ... endpoints A good surrogate marker accounts fora larger percentage of treatment effect For instance, if atreatment reduces the risk for death by 20% and improvement in a biomarker was associated with ... from ≥1 for renal SOFA to ≥4 for cardiovascular and respiratory SOFA Page of 11 (page number not for citation purposes) Critical Care Vol 12 No Shorr et al Table PROWESS and ENHANCE patient baseline...
... Ishihara M, Kamiya N, Komiya A, Shimbo M, Suyama T, Sakamoto S, and Ichikawa T Bisphosphonate and low-dose dexamethasone treatmentfor patients with hormone-refractory prostate cancer Hinyokika ... Neville A, and Tannock IF Economic evaluation of chemotherapy with mitoxantrone plus prednisone for symptomatic hormone-resistant prostate cancer: based on a Canadian randomized trial with palliative ... treatmentfor many years, there are aggressive forms with rapid growthand early metastatic spreading The current therapeutic options in the treatment of PCa are: i) Radical excision of prostate and...
... renal impairment Standard measures to prevent and treat hyperuricemia include allopurinol and alkalinization, associated with an aggressive hydration Rasburicase presents various features that ... because each metabolic derangement is associated with remarkable clinical manifestations Hyperuricemia and hyperphosphatemia severely worsen renal functionality; hyperkalemia and hypocalcemia ... kinetics and bioavailability Intravenous, oral and rectal administration Cancer Chemother Pharmacol 1982;8:93-98 Jaeger H, Russmann D, Rasper J, Blome J Comparative study of the bioavailability and...
... TGGACGGATATTGAAGCTGATCTCACCATAAAGGAT ATCCTTTATGGTGAGATCAGCTTCAATATCCGTCCA TTAAAGGCTATCAAATCGCAAGAACAGTTCACTAGA TCTAGTGAACTGTTCTTGCGATTTGATAGCCTTTAA GAAGCAAGAACAGTTCACTTAGTCAATTGATTAACGTG CACGTTAATCAATTGACTAAGTGAACTGTTCTTGCTTC ... sheets and 8, the AAA domain helix and the C-terminal helix) However, the majority of these proteins are likely to be other meiotic clade AAA ATPases and have the AAA domain helix and the C-terminal ... IgG) was from Zymed (San Francisco, CA, USA) Horseradish peroxidaseconjugated goat anti-(mouse IgG) and gel-filtration standards were from Bio-Rad Laboratories (Hercules, CA, USA) Penta His mAb and...
... Based on an analysis of the possible clinical scenarios, a new classification system is introduced in an effort to organize the diagnostic process Anatomical relationships that allow an innovative ... surgical options Gingival excision will result in inadequate band of attached gingiva No flexibility A staged approach is not advantageous May require a surgical referral The biologic width encompasses ... uninflamed and inflamed gingival and alveolar mucosa J Periodontol 1959;30:208 Schroeder H Differentiation of Human Oral Stratified Epithelia Switzerland: Kager, 1981 Squier CA Keratinization...
... HspH variant; lane 2, His6-tagged HspH variant and untagged HspH after copurification (B) Interaction of tagged and untagged HspH(Na) Lane 3, HspH(Na)-His after purification; lane 4, copurification ... or lacking chaperone activity [24,25,42] The chaperone activity of mammalian a- crystallins, on the other hand, appears to be much more resistant against structural modifications Human aB-crystallin ... from native HspH and HspF with regard to chaperone activity and oligomeric state They prevented CS aggregation (Fig 2A, E), and their apparent molecular mass of 350–480 kDa was consistent with...
... Ladouceur M, Barbeau H: A treadmill apparatus and harness support for evaluation and rehabilitation of gait Arch Phys Med Rehabil 1995, 76:772-778 Kamel HK, Iqbal MA, Mogallapu R, Maas D, Hoffmann RG: ... and balance in a wide range of categories of patients The system allows natural mediolateral APAs to occur across a wide range of gravity-like loads, an important balance related stimulus that ... results of the mediolateral critical time parameter Pre- and3 Pre- and post-training results of the mediolateral critical time parameter Changes in the mediolateral critical time parameter under eyes-closed...
... Fanjason Ramahaleomiarantsoa, Eric Jean Roy Sambatra, Nicolas Hộraud and Jean Marie Razafimahenina Chapter Dynamic and Quasi-Static Simulation of a Novel Compliant MEMS Force Amplifier by Matlab/Simulink ... Balogh, Pavel Zỏskalický, S Chountasis, V.N Katsikis, D Pappas, Mohammed Z Al-Faiz, Abbas H Miry, Ramy Saad, Sebastian Hoyos, Samuel Palermo, Momoh-Jimoh E Salami, Ismaila B Tijani, Abdussamad ... Transformer Using Matlab 219 Adel Aktaibi and M Azizur Rahman Chapter 11 PH Control Using MATLAB 243 Mostefa Ghassoul Chapter 12 An Advanced Transmission Line and Cable Model in Matlab for the...
... Prokop, Walid Hassairi, Moncef Bousselmi, Mohamed Abid, Carlos Valderrama, Moulay Tahar Lamchich, Nora Lachguer, Gaizka Almandoz, Gaizka Ugalde, Javier Poza, Ana Julia Escalada, Oriol Font-Bach, Antonio ... Software for Design and Analysis of Electrical Machines 161 Gaizka Almandoz, Gaizka Ugalde, Javier Poza and Ana Julia Escalada Section Telecommunication-Communication Systems 185 Chapter MATLAB as ... in Matlab: Issues and Impairments 217 Bahman Azarbad and Aduwati Binti Sali Chapter 11 Wireless Channel Model with Markov Chains Using MATLAB 235 Diana Alejandra Sánchez-Salas, José Luis Cuevas-Ruíz...
... thermal imaging of the wrist and MCP, normal adult wrists and hands from controls were imaged on separate days Three thermal scans were obtained at each session and the HDI was calculated for each ... participated in its design and coordination, and helped to draft the manuscript All authors read and approved the final manuscript Acknowledgements The authors thank Taschawee Arkachaisri, Daniel ... participated in study design, data acquisition, processing, analysis, and in preparation of the manuscript JE participated in data acquisition and analysis CKK participated in study design and...
... integrated and practical tool to assist QI researchers, healthcare professionals, and managers responsible for developing, delivering and evaluating CE and QI programmes at a national or regional ... Durieux Italy: Unit of Clinical Governance, Agenzia Sanitaria Regionale (Regional Health Care Agency) of Emilia-Romagna, Bologna Partner manager – Roberto Grilli Italy: Center for the Evaluation ... project It is a software program that packages information on the design and evaluation of evidence-based QI interventions into an integrated, easily accessible, and practical tool In this paper, we...
... were as follows: EGFR gene forward primer, 5' -CGAGGGCAAATACAGCTTTG -3'; backward primer, 5'- CCTTCGCACTTCTTACACTTG -3'; probe 5'FAM-ACGCCGTCTTCCTCCATCTCATA GCTAMRA3' Thermal cycler parameters ... that RNAi-mediated silencing of EGFR may provide an opportunity to develop a new treatment strategy for NSCLC Materials and methods Cell lines and cell culture A5 49 and SPC -A1 are well-characterized ... Genetic Vaccines and Therapy 2005, 3:5 Background Lung cancer is a leading cause of cancer death in Australia and the world [1,2] There are two types of lung cancers, non small cell (NSCLC) and small...
... of Japan SIG Notes NL-127, pages 173–178, September In Japanese Takashi Miyata, Kazuma Takaoka, and Yuji Matsumoto 1999 Implementation of GUI debugger for unification-based grammar In Information ... by human debuggers In addition, human debuggers can delete partial parsing trees manually later Figure shows a concrete example (NP and S are labels for noun and sentential POS/label from Tagged ... practical applications In Proc of the Workshop on Grammar Engineering and Evaluation, pages 15–21 Patrick Paroubek, Yves Schabes, and Aravind K Joshi 1992 XTAG – a graphical workbench for developing...
... displayed It is possible to edit the examples and frames associated witha lexical unit via the Examples and Frames tab Frames specify the syntactic valence of a lexical unit Each frame can have an ... well This would mean that the wordnet data fora given language would have to be stored in a relational database and that the tool itself can handle the language specific data structures of the ... frame can have an associated example that indicates a possible usage of the lexical unit for that particular frame The tab Examples and Frames is thus particularly geared towards the editing of...
... of each growth unit A stem analysis gave basal area (at breast height) and bole volincrements for each year Disks were analat year intervals along the bole For each disk, annual radial increments ... surface area) and measurements of tree growth (annual basal area and bole volume increments) A strong allometric relation exists between the measured tree basal area and calculated crown surface ... Margolis HA (1992) Factors affecting the relationship between sapwood area and leaf area of balsam fir Can J For Res 22, 1684-1693 Dong PH, Laar A Van, Kramer H (1989) [A model for research on forest...
... Arthritis Research & Therapy Vol No Andersson et al combined with the retrieval of potential candidate genes found in different databases Information about RA and related genome data is available ... this approach also manages to predict several candidate genes that are already established in the literature Thus, the CGC application is a helpful toolfor finding candidate genes associated with ... data mining, we have created a tool, the Candidate Gene Capture (CGC) application, that makes keyword-based searches on textual information for genes situated within selected human chromosomal...
... Critical Care Vol 11 No Fagon et al Table Outcomes and antibiotics in the Canadian Critical Care Trials Group study [1] Endotracheal aspiration (n = 374) Bronchoalveolar lavage (n = ... Inappropriate use of antibiotics and the risk for delayed admission and masked diagnosis of infectious diseases: a lesson from Taiwan Arch Intern Med 2001, 161:2366-2370 Canadian Critical Care ... Canadian study are consistent with those of the three Spanish trials (Table 2) in which antimicrobial treatment was also initiated in all suspected patients and rarely withheld in patients with...
... creation of user accounts and grants access to the application features, once a user has been authenticated and authorized It allows a user to add and manage projects The TrackStar Application ... $this->render('helloWorld',array('time'=>$theTime)); When calling render() witha second parameter containing array data, it will extract the values of the array into PHP variables and make those variables available ... Each AR object in Yii is an instance of CActiveRecord or its child class that wraps a single row in a database table or view, encapsulates all the logic and details around database access, and...