as a specific version of the international classification of diseases
Báo cáo y học: "Identification of a SmD3 epitope with a single symmetrical dimethylation of an arginine residue as a specific target of a subpopulation of anti-Sm antibodies" ppsx
... peptide-based assay (99.8%; data not shown) Further studies are in progress to compare the assay performance of the anti-SMP assay with that of other commercially available anti-Sm immunoassays For ... dimethylated arginine residues for epitopes assay Assay performance characteristics of the anti-SmD3 peptide (SMP) assay (a) Intra-assay and interassay variability, (b) linearity, and (c) receiver operating ... an east Indian patient, and one from an oriental patient The racial background of four patients was not known Of these patients, 13 were male and 86 female (in two the sex was unknown), and the...
- 11
- 593
- 0
Báo cáo hóa học: "IL-2 as a therapeutic target for the restoration of Foxp3+ regulatory T cell function in organ-specific autoimmunity: implications in pathophysiology and translation to human disease" doc
... type diabetes subjects Immunogenetics 2010, 62:101-107 36 Kawasaki E, Awata T, Ikegami H, Kobayashi T, Maruyama T, Nakanishi K, Shimada A, Uga M, Kurihara S, Kawabata Y, et al: Genetic association ... feasibility of translating these therapies to humans remains to be assessed One potential limitation of the process is the identification of those antigens that are the most relevant as targets, as the ... to assess the effects and benefits of this double therapy Combination therapy with cellular infusion The idea of cellular therapy has also been examined The major challenge in this case is the...
- 12
- 573
- 0
báo cáo hóa học: " Change in patient concerns following total knee arthroplasty described with the International Classification of Functioning, Disability and Health: a repeated measures design" docx
... Ontario Physiotherapy Association to Ravi Rastogi 20 21 The study was completed by Ravi Rastogi in partial fulfilment of the requirements for the degree of Master of Science at the School of ... RR, AMD and BMC designed the study RR collected and analyzed the data and drafted the manuscript with regular feedback from AMD and BMC All authors read and approved the final manuscript 18 19 Acknowledgements ... work was supported by a Premier's Research Excellence Award from the Ontario Ministry of Health and Long-term Care to Dr Davis and by the Dr Jal Tata Research Award from the London district of the...
- 8
- 458
- 0
báo cáo hóa học:" Content comparison of haemophilia specific patient-rated outcome measures with the international classification of functioning, disability and health (ICF, ICF-CY)" pdf
... factors’; the latter are not classified in the ICF because of the large social and cultural variance associated with them The units of the ICF classification are called categories; they are organized ... comparison of all the measures’ contents for the choice of instruments in the field of haemophilia In addition to the International Classification of Diseases (ICD-10) [34], the World Health Organisation ... problems walking downstairs” from the HEP-TestQ asks about the impact of the disease for a specific action of walking From a methodological point of view, while the quality of linking was assured, the...
- 14
- 356
- 0
Báo cáo y học: " Self-reported sickness absence as a risk marker of future disability pension. Prospective findings from the DWECS/DREAM study 1990-2004"
... used to analyse the associations between the risk factors and the outcome variable The analysis was performed in three stages: initially, analysis was performed to establish the association between ... Additional analysis treating days of sickness absence during 1990 as a continuous variable showed a clear trend of increase in disability pension risk with increase in absence days/yr A 10-day increase ... Ministry of Employment, the Ministry of Social Affairs and the Ministry of Education DWECS was conducted in 1990, and featured a random sample drawn from the Central Population Register of Denmark of...
- 6
- 578
- 0
Tài liệu Interest on Excess Reserves as a Monetary Policy Instrument: The Experience of Foreign Central Banks ppt
... which has traded on average about basis points below the Bank Rate over this period, occasionally falling below the Bank Rate by as much as 35 basis points Bank of Canada The Bank of Canada (BoC) ... case studies that form the basis for the findings The eight central banks covered are: the Reserve Bank of Australia, the Bank of Canada, the Bank of England, the European Central Bank, the Bank ... Monetary Affairs) and Spence Hilton (Federal Reserve Bank of New York), as well as from central bank colleagues at the Reserve Bank of Australia, the Bank of Canada, the Bank of England, the European...
- 49
- 653
- 0
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc
... GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢) (N ¼ A, T, G, C) and pykback (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) for amplification of pyk The resulting PCR ... the formate flux and Clas Jacetate Clas % ðÀ0:4Þ for the acetate flux 2295 Control analysis of the las operon B Koebmann et al Fig Construction of a strain with the pyk gene deleted from the las ... (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4 (5¢-CTAGTCTAGATGAGCTCCAGAAGCTTCC-3¢) were amplified The PCR products were digested with XhoI ⁄ BamHI and BamHI ⁄ XbaI, respectively, and cloned...
- 12
- 616
- 0
Comparison of the obstetric anesthesia activity index with total delivery numbers as a single denominator of workload demand in Israeli maternity units doc
... (1) The ratio of the epidural and cesarean components of the OAAI (OAAI EPI and OAAI CD) was also calculated as follows: OAAICD/EPI = ( no of cesareans per yr *1.5 ) / ( no of epidurals per ... patient-controlled analgesia pumps The OAAI ignores clinical activities other than epidural analgesia and cesarean anesthesia (including anesthesia for retained placenta and complicated vaginal deliveries, antenatal ... allocated for the provision of obstetric anesthesia services The OAAI was calculated based on the premise that epidurals and cesareans are the predominant determinants of obstetric anesthesia...
- 14
- 610
- 0
Báo cáo khoa học: Nup358, a nucleoporin, functions as a key determinant of the nuclear pore complex structure remodeling during skeletal myogenesis docx
... 5¢-GCAGCAUCUUUAAUGAAUAdTdT-3¢ and 5¢-AUAAGUAAUUUCUACGACG dTdT-3¢; Nup358, 5¢-CCAGUCACUUACAAUUAAAd TdT-3¢ and 5¢-UUUAAUUGUAAGUGACUGGdTdT-3¢ (siNup358-1), 5¢-UGAAGCACAUGCUAUAAAAdTdT-3¢ and 5¢-UUUUAUAGCAUGUGCUUCAdTdT-3¢ ... CCACCGCTTGAGAGACTTACTCTTGATTGTAACGA GGATA-3¢ and 5¢-AGCTTATCCTCGTTACAATCAA GAGTAAGTCTCTCAAGCGGTGGTAGCTGAAGAGG A- 3¢) were annealed and inserted into the BglII and HindIII sites of pEGFP-NLS The oligonucleotide ... GDP, across the nuclear envelope regulates the binding and release of cargo by transport factors RanGTP is abundant in the nucleus as a result of the activity of RCC1, a guanine nucleotide exchange...
- 12
- 454
- 0
Báo cáo khoa học: The modulation of metal bio-availability as a therapeutic strategy for the treatment of Alzheimer’s disease pptx
... hyperphosphorylation occurs because of an imbalance in the activity of tau kinases and phosphatases [3] One particular tau kinase pertinent to metal dyshomeostasis in AD is glycogen synthase kinase-3 ... down-regulated by decreased availability of intracellular Cu [83] and up-regulated by increased availability of Cu [84] Collectively, these data present a strong case for the native role of APP ⁄ Ab ... Modulation of metal availability for treating AD P J Crouch et al research attention as potential therapeutic targets Plaques and NFTs, however, cannot be regarded as ‘upstream’ causative factors...
- 9
- 634
- 0
Báo cáo khoa học: The hyperfluidization of mammalian cell membranes acts as a signal to initiate the heat shock protein response pptx
... present case The heat-induced activation of kinases such as Akt has been shown to increase HSF1 activity Enhanced Ras maturation by heat stress was associated with a heightened activation of extracellular ... Morphological study of the mammalian stress response: characterization of changes in cytoplasmic organelles, cytoskeleton, and nucleoli, and appearance of intranuclear actin filaments in rat fibroblasts after ... steady-state fluorescence anisotropy was measured as in [45] When the temperature dependence of fluidity was followed, the temperature was gradually (0.4 °CÆmin)1) increased and the anisotropy data...
- 10
- 452
- 0
Báo cáo khoa học: Identification of NF1 as a silencer protein of the human adenine nucleotide translocase-2 gene pptx
... were dried and autoradiographed Competitor DNAs used in EMSA analysis were: NF1 wt, 5¢-TTTTG GATTGAAGCCAATATGATA-3¢; NF1 mut, 5¢-TTTT GGATTGAATAAAATATGATA-3¢; Site-2 wt, 5¢-GCGT CTCACCCTAGTCCTGGTCCTGCTCCAAGGGTTTT ... activities were measured as described [17] DNase I protection assay Rat liver and HeLa nuclear extracts were prepared as described previously [18,19] The DNase I protection assay was performed as described ... binding activity in all fractions was monitored by the in vitro DNase I protection assay The DNA affinity column, used as the last step in the purification, was prepared with an oligonucleotide containing...
- 8
- 426
- 0
Application of the International Classification of Diseases to Dentistry and Stomatology Third Edition potx
... Tularaemia A2 1.0 Ulceroglandular tularaemia A2 1.0X Oral manifestations A2 1.8 Other forms of tularaemia A2 1.8X Oral manifestations Anthrax A2 2.8 Other forms of anthrax A2 2.8X Oral manifestations ... consisting of a relatively small number of broad headings, or in an expanded form that allows detailed analysis in areas of special interest The International Classification of Diseases Readers and ... Library Cataloguing in Publication Data Application of the International Classification of Diseases to dentistry and stomatology: ICD-DA — 3rd ed 1.Mouth diseases — classification 2.Mouth neoplasms...
- 246
- 1,856
- 0
Báo cáo " Using multi‐criteria analysis as a tool to select the feasible measures for sustainable development of brackish water shrimp culture in Quang Tri Province " doc
... of the wastewater problems near shrimp ponds. These are: (i) Spatial boundaries: the location of the shrimp farms has to stay nearby the river estuaries; The available space ... environment [3]. One of the disadvantages is that the relative importance of evaluation criteria is determined without considering the scales on which the criteria are measured. Another disadvantage is the large amount of ... those measures that are being used in the target areas as well as foreign countries, such as Indonesia, China, Bangladesh, Germany, Mexico, Colombia, USA. Some of them are introduced as follows. ...
- 13
- 487
- 0
Báo cáo khoa học: Identification of mitogen-activated protein⁄extracellular signal-responsive kinase kinase 2 as a novel partner of the scaffolding protein human homolog of disc-large docx
... RT-PCR using PlatiniumÒ Taq DNA High Fidelity Polymerase (Invitrogen) and the primers: PDZ-1-2, forward: 5¢-CCGAATTCGAAGAAATCACACTTGAAAGG-3¢, and reverse: 5¢GGATCCCCATCATTCATATACATACTTGT GGGTT-3¢; ... mutagenic primers were: GRRF-PDZ1: 5¢GAAAGGGGAAATTCAGGGCGTCGT TTCAGCATTGCAGGAGG-3¢; GRRF-PDZ2: 5¢-ATTA AAGGTCCTAAAGGTCGTCGGTTTAGCATTGCTGGA GG-3¢; RAAV-MEK2: 5¢-CACCCACGCGCGCCGCCGT GTGA-3¢ and ... least one MAPK implicated in ERK activation to facilitate a functional interaction and regulate the localization and the duration of the signal For example, the MEK partner directs the ERK cascade...
- 11
- 419
- 0
Đề tài " A quantitative version of the idempotent theorem in harmonic analysis " docx
... refinement of) Ruzsa’s analogue of Freiman’s theorem, which gives a fairly strong characterisation of subsets A ⊆ Fn satisfying a small doubling condition |A + A| K |A| An analogue of this theorem for any ... suppose that there are at least δ |A| 3 additive quadruples (a1 , a2 , a3 , a4 ) in A4 with a1 + a2 = a3 + a4 Then there is a regular Bourgain system S satisfying dim(S) Cδ −C ; |S| e−Cδ −C |A| and ... , was obtained in [12] The argument there, which was a combination of [12, Lemma 3.4] and [12, Prop 3.7], was somewhat elaborate and involved polynomials which are small near small integers The...
- 31
- 523
- 0
Báo cáo khoa học: Distribution of the extrinsic proteins as a potential marker for the evolution of photosynthetic oxygen-evolving photosystem II ppt
... Rhodophyceae (red algae) Cyanidioschyzon merolae Nuclear DNA Chloroplast DNA Cyanidium caldarium Chloroplast DNA Bacillariophyceae (diatoms) Thalassiosira pseudonana Nuclear DNA Chloroplast DNA Odontella ... for details), although it was not detected by the immunological assays Psb P Cyanobacteria Glaucophyceae Red algae Diatoms Haptophyceae Brown algae Prasinophyceae Euglenophyceae Green algae Higher ... suggests that C paradoxa PsbU has a higher homology with the red algal protein than with the cyanobacterial one The C paradoxa thylakoid membranes also contained a band cross-reacted with anti-(R-PsbQ¢),...
- 11
- 501
- 0
báo cáo hóa học: " Comparing the content of participation instruments using the International Classification of Functioning, Disability and Health" pdf
... since these questions ask about aspects of participation The ICF classification was then used to assign ICF categories to the meaningful concepts In the ICF classification the components are labeled ... the ICF (e.g suicide attempts) it was coded as 'not covered' [8] A meaningful concept was coded as a 'personal factor' if it asks about age or other factors that relate to the background of the ... in the International Classification of Functioning, Disability and Health (ICF) as the 'involvement in a life situation' and participation restrictions are defined as 'problems an individual may...
- 12
- 541
- 0
báo cáo hóa học: " Validation of a Chinese version of disease specific quality of life scale (HFS-36) for hemifacial spasm in Taiwan" docx
... by a native English speaker We repeated back-translations and made further modifications until a consensus was reached The second step was to examine whether the HSF-36 Chinese version has an appropriate ... Inc., Chicago) was used for data analysis and the significant level was set up at p < 0.05 An intra-class correlation (ICC) approach was used to examine the test-retest reliability of HFS-36 ... SF-36, HFS-36 scale was sensitive and specific to evaluate the mental health in HFS, such as the stigma and embarrassment Moreover, HFS-36 also detected the impact to physical health, like difficulty...
- 8
- 601
- 0
báo cáo hóa học: " Validity and internal consistency of a Hausa version of the Ibadan knee/hip osteoarthritis outcome measure" pdf
... interview All the patients reported clarity of the Hausa language and ease of understanding of all the items The final version of the Hausa translation of IKHOAM (see Additional file 2) The anchors (English) ... of IKHOAM The divergent validity of the Hausa version of IKHOAM was analyzed by subjecting participants' scores on the Visual Analogue Scale and the Hausa version of IKHOAM to Spearman rank Order ... correlation Internal consistency of the parts of the Hausa version of IKHOAM was calculated using the Cronbach's alpha Level of significance was set at 0.05 The SPSS 12 software program was used...
- 5
- 458
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose