are some cancer cells primed for death but waiting for a final push pdf

Báo cáo y học: "Differential cytopathogenesis of respiratory syncytial virus prototypic and clinical isolates in primary pediatric bronchial epithelial cells" pdf

Báo cáo y học: "Differential cytopathogenesis of respiratory syncytial virus prototypic and clinical isolates in primary pediatric bronchial epithelial cells" pdf

Ngày tải lên : 11/08/2014, 21:22
... TNF-related apoptosis-inducing ligand (TRAIL) and vascular endothelial growth factor (VEGF) All values are means of individual donors ± SE Data were analyzed using One-Way repeated measures ANOVA ... Bermejo-Martin JF, Alonso A, Matias V, Tenorio A, Rico L, Eiros JM, Castrodeza J, Blanco-Quiros A, Ardura J, de Lejarazu RO: Nasopharyngeal aspirate cytokine levels yr after severe respiratory syncytial ... G gene of each isolate was amplified in a one-step RT-PCR reaction using RSV G-specific primers (Fw: ACCTCAACATCTCACCATGC; Rev: AGAGTGAGACTGCAGCAAGG) (One step RT-PCR Kit, Quigen) Amplicons were...
  • 9
  • 261
  • 0
Clinical significance of cancer stem cell markers and other related proteins in colorectal carcinomas   biological and methodological considerations

Clinical significance of cancer stem cell markers and other related proteins in colorectal carcinomas biological and methodological considerations

Ngày tải lên : 03/10/2015, 20:57
... SUMMARY Colorectal cancer remains one of the leading causes of cancer- related deaths in Singapore The colorectal cancer is a heterogeneous disease There are at least three major molecular pathways ... available as “categorical” values for statistical analysis (Walker et al., 2006) Having the values scoring as a continuous variable allow for more sensitive statistical analysis As computer-aided measurements ... namely a) a hospital-based model for translational research making use of amplifiable DNA from formalin-fixed paraffin-embedded tissue blocks archived as early as 50 years ago; and b) a reliable method...
  • 116
  • 277
  • 0
Báo cáo y học: "yrosine kinase – Role and significance in Cancer"

Báo cáo y học: "yrosine kinase – Role and significance in Cancer"

Ngày tải lên : 03/11/2012, 09:57
... signaling pathways are often genetically or epigenetically altered in cancer cells to impart a selection advantage to the cancer cells Thus, it is no wonder that aberrant enhanced signaling emanating ... of breast cancer, prostrate cancer and small cell lung cancer [27] Elevated IGF-I R autophosphorylation and kinase activity has been reported in breast cancer [28] Elevated prostrate cancer risk ... bladder and cervical carcinomas Breakpoints of abnormal chromosomal translocation are also an important source of mutation [13] 4.1.1 BCR-ABL and human leukemia CML is a chronic myelodysplastic...
  • 15
  • 570
  • 0
Coexisting Bronchogenic Carcinoma and Pulmonary Tuberculosis in the Same Lobe: Radiologic Findings and Clinical Significance doc

Coexisting Bronchogenic Carcinoma and Pulmonary Tuberculosis in the Same Lobe: Radiologic Findings and Clinical Significance doc

Ngày tải lên : 22/03/2014, 18:20
... acid-fast bacilli The time required for the diagnosis of cancer with inactive TB is somewhat shorter when the disease processes are located in different areas When cancer is associated with active ... adenocarcino- A ma in three cases, and squamous cell carcinoma in two (Figs and 2) Three patients had old tuberculous granulomas and lung cancers in the same lobe, but pathologic examination showed that ... scans and the stage of the cancer was also determined If the short diameter of a lymph node was greater than cm, this was taken to indicate metastatic lymphadenopathy Twenty-one of the 51 patients...
  • 7
  • 518
  • 1
Báo cáo hóa học: " Multiplexed methylation profiles of tumor suppressor genes and clinical outcome in lung cancer" potx

Báo cáo hóa học: " Multiplexed methylation profiles of tumor suppressor genes and clinical outcome in lung cancer" potx

Ngày tải lên : 18/06/2014, 16:20
... clinical and laboratory data, data analysis and interpretation, and drafted the manuscript PP and LG participated in acquiring clinical and laboratory data, data analysis and data interpretation and ... further data processing Automated fragment and data analysis was performed exporting the peak areas to an excel-based analysis program (Coffalyser V8, MRCHolland) For hypermethylation analysis ... early to advanced stages It was also required to have tissue material available for obtaining high-quality DNA for methylation analyses Of the 54 NSCLC patients, 22 had TNM Stage I-II, 18 had...
  • 11
  • 411
  • 0
Báo cáo hóa học: " Co-evolution of cancer microenvironment reveals distinctive patterns of gastric cancer invasion: laboratory evidence and clinical significance" pptx

Báo cáo hóa học: " Co-evolution of cancer microenvironment reveals distinctive patterns of gastric cancer invasion: laboratory evidence and clinical significance" pptx

Ngày tải lên : 18/06/2014, 16:20
... during cancer invasion Traditionally, extracellular proteolysis and BM breaching are two absolute requirements for cancer invasion, while type IV collagen forms physical barrier against cancer invasion ... survival was calculated by the Kaplan-Meier method and analyzed by the Log-rank test A secondary analysis was performed to assess the relationship among immunohistochemical variables and clinicopathological ... proteases facilitate ECM degrading, thereby creating a path for the migration of cancer cells As a result of this path through the ECM, the invading cancer cells could gain access to vasculature and...
  • 11
  • 401
  • 0
Báo cáo y học: "Sub-optimal CD4 reconstitution despite viral suppression in an urban cohort on Antiretroviral Therapy (ART) in sub-Saharan Africa: Frequency and clinical significance" ppt

Báo cáo y học: "Sub-optimal CD4 reconstitution despite viral suppression in an urban cohort on Antiretroviral Therapy (ART) in sub-Saharan Africa: Frequency and clinical significance" ppt

Ngày tải lên : 10/08/2014, 05:21
... Mayanja-Kizza H, Kambugu A, Bakeera-Kitaka S, Semitala F, Mwebaze-Songa P, Castelnuovo B, Schaefer P, Spacek LA, Gasasira AF, et al.: Predictors of long-term viral failure among ugandan children and adults ... H, Katabira E, Kamya MR: Eligibility for HIV/AIDS treatment among adults in a medical emergency setting at an urban hospital in Uganda Afr Health Sci 2007, 7(3):124-128 Huttner AC, Kaufmann GR, ... findings are comparable to results from other developing countries (Africa, Latin America and Asia) where 19% of patients had SOCD4 using a similar criteria of a CD4 increase of < 50 cells/ μl after...
  • 9
  • 301
  • 0
Báo cáo y học: "Clinical significance in the number of involved lymph nodes in patients that underwent surgery for pathological stage III-N2 non-small cell lung cancer" pot

Báo cáo y học: "Clinical significance in the number of involved lymph nodes in patients that underwent surgery for pathological stage III-N2 non-small cell lung cancer" pot

Ngày tải lên : 10/08/2014, 09:22
... Log-rank test for a univariate analysis Prognostic factors were analyzed by a multivariate analysis using Cox’s proportional hazard model to adjust for potential confounding factors Categorical variables ... months for the first years after surgery and annually thereafter The mean duration of observation was 57 months The survival curve was calculated by the Kaplan-Meier method, and the data were compared ... pathologic TNM stage in surgically managed non-small cell lung cancer J Thorac Oncol 2009, 4:792-801 10 Goya T, Asamura H, Yoshimura H, Kato H, Shimokata K, Tsuchiya R, Sohara Y, Miya T, Miyaoka...
  • 8
  • 484
  • 0
báo cáo khoa học: "Expression and prognostic significance of cancer-testis antigens (CTA) in intrahepatic cholagiocarcinoma" ppt

báo cáo khoa học: "Expression and prognostic significance of cancer-testis antigens (CTA) in intrahepatic cholagiocarcinoma" ppt

Ngày tải lên : 10/08/2014, 10:20
... Usefulness of cancer- testis antigens as biomarkers for the diagnosis and treatment of hepatocellular carcinoma J Transl Med 2007, 5:3 Kikuchi E, Yamazaki K, Nakayama E, Sato S, Uenaka A, Yamada N, Oizumi ... speculated that a relatively high proportion of HLA Class I-negative cases in MAGE -A3 /4 positive group may partly account for its association with significantly poor survival MAGE -A1 , MAGE -A3 /4 and ... overlap in the expression of cancer- testis antigens in intrahepatic cholagiocarcinoma Figure Immunohistochemical analysis of MAGE -A1 , MAGEA3/ 4, NY-ESO-1 and HLA Class I in intrahepatic cholagiocarcinoma...
  • 6
  • 414
  • 0
Báo cáo y học: " Expression, regulation and clinical significance of soluble and membrane CD14 receptors in pediatric inflammatory lung diseases" pptx

Báo cáo y học: " Expression, regulation and clinical significance of soluble and membrane CD14 receptors in pediatric inflammatory lung diseases" pptx

Ngày tải lên : 12/08/2014, 11:21
... Basel, Switzerland), and/or the presence of specific IgE (RAST class >2) The RAST was performed for forty inhalation and food allergens (Sanofi Diagnostics Pasteur, Inc, Chaska, MN) All asthma ... the manuscript PL performed statistics MG and AH characterized the study population, performed bronchoalveolar lavage and participated in the study design TN performed bronchoalveolar lavage and ... Diagnostic value of the serological markers for diagnosis of bacterial pneumonia and receiver operator characteristics (ROC) curves were calculated using STATA® version 8.2 for Windows (STATA Corporation,...
  • 13
  • 407
  • 0
Báo cáo y học: "Natural history and clinical significance of MRI-detected bone marrow lesions at the knee: a prospective study in community dwelling older adults" pot

Báo cáo y học: "Natural history and clinical significance of MRI-detected bone marrow lesions at the knee: a prospective study in community dwelling older adults" pot

Ngày tải lên : 12/08/2014, 15:22
... Geneva, Geneva, Switzerland) and were defined as areas of increased signal adjacent to the subcortical bone at the medial tibial, medial femoral, lateral tibial, and lateral femoral sites One trained ... software to deal with data of this sort in longitudinal analysis As a result we have performed two separate analyses examining, 1) BML size change at all four sites (medial tibial, medial femoral, ... included National Health and Medical Research Council of Australia, Tasmanian Community Fund, Masonic Centenary Medical Research Foundation, Royal Hobart Hospital Research Foundation, and Arthritis...
  • 12
  • 333
  • 0
Báo cáo khoa học: A study of microRNAs in silico and in vivo: diagnostic and therapeutic applications in cancer pot

Báo cáo khoa học: A study of microRNAs in silico and in vivo: diagnostic and therapeutic applications in cancer pot

Ngày tải lên : 16/03/2014, 01:20
... Cordon-Cardo C, Lowe SW, Hannon GJ et al (2005) A microRNA polycistron as a potential human oncogene Nature 435, 828–833 39 Hayashita Y, Osada H, Tatematsu Y, Yamada H, Yanagisawa K, Tomida S, Yatabe ... Natl Acad Sci USA 103, 2208–2213 59 Karube Y, Tanaka H, Osada H, Tomida S, Tatematsu Y, Yanagisawa K, Yatabe Y, Takamizawa J, Miyoshi S, Mitsudomi T et al (2005) Reduced expression of Dicer associated ... regions involved in cancers Proc Natl Acad Sci USA 101, 2999–3004 36 Takamizawa J, Konishi H, Yanagisawa K, Tomida S, Osada H, Endoh H, Harano T, Yatabe Y, Nagino M, Nimura Y et al (2004) Reduced...
  • 8
  • 432
  • 0
NUTRITION AND METABOLISM Underlying Mechanisms and Clinical Consequences pdf

NUTRITION AND METABOLISM Underlying Mechanisms and Clinical Consequences pdf

Ngày tải lên : 22/03/2014, 19:20
... interventional studies, available data supporting the above are largely circumstantial and observational in nature We all realize, however, that if we are to make pervasive and enduring changes to ... recommendation for those with cardiovascular disease includes reduction of salt, saturated and trans fats and increases in dietary fiber, antioxidants, B vitamins, omega-3 fatty acids, mono-unsaturated ... overall quality of life Pertinent randomized controlled clinical trial and meta-analysis data are discussed and when these are not available, or not fully elucidate relevant questions, data from...
  • 420
  • 327
  • 0
ONCOGENOMICS AND CANCER PROTEOMICS – NOVEL APPROACHES IN BIOMARKERS DISCOVERY AND THERAPEUTIC TARGETS IN CANCER pot

ONCOGENOMICS AND CANCER PROTEOMICS – NOVEL APPROACHES IN BIOMARKERS DISCOVERY AND THERAPEUTIC TARGETS IN CANCER pot

Ngày tải lên : 30/03/2014, 09:20
... Molecular Signatures to Clinical Oncology Translation 39 [55] Aarnio M, Sankila R, Pukkala E, Salovaara R, Aaltonen LA, de la Chapelle A, et al Cancer risk in mutation carriers of DNA-mismatch-repair ... protocols are implemented for RNA labeling, hybridization, data processing, data acquisition, and data normalization When these technical variables are standardized, different microarray platforms can ... Contributors Norfilza M Mokhtar, Nor Azian Murad, Then Sue Mian, Rahman Jamal, Elena AréchagaOcampo, Nicolas Villegas-Sepulveda, Eduardo Lopez-Urrutia, Mayra Ramos-Suzarte, César López-Camarillo,...
  • 238
  • 579
  • 0
cell cycle control mechanisms and protocols methods in molecular biology - tim humphrey, gavin brooks

cell cycle control mechanisms and protocols methods in molecular biology - tim humphrey, gavin brooks

Ngày tải lên : 08/04/2014, 12:50
... M., Nakaseko, Y., Kumada, K., Nakagawa, T., and Yanagida, M (1999) Fission yeast APC/cyclosome subunits, Cut20/Apc4 and Cut23/Apc8, in regulating metaphase-anaphase progression and cellular stress ... chromatid cohesion at the metaphase to anaphase transition in yeast Cell 93, 1067–1076 Kumada, K., Nakamura, T., Nagao, K., Funabiki, H., Nakagawa, T., and Yanagida, M (1998) Cut1 is loaded onto ... cell wall Most animal cells lack a rigid extracellular coat and can move and change their shape relatively freely Almost all higher plant cells are completely encased in a comparatively rigid carbohydrate-based...
  • 409
  • 876
  • 0
báo cáo hóa học:" RAGE (Receptor for Advanced Glycation Endproducts), RAGE Ligands, and their role in Cancer and Inflammation" pptx

báo cáo hóa học:" RAGE (Receptor for Advanced Glycation Endproducts), RAGE Ligands, and their role in Cancer and Inflammation" pptx

Ngày tải lên : 18/06/2014, 15:20
... cytosol for active and passive secretion Although as a cautionary note, HMGB2 and HMGB3 are also upregulated in some cancers, and might play a role as RAGE activators in addition to HMGB1 The similarity ... Fibrosis Am J Pathol 2008, 172:583-591 Yonekura H, Yamamoto Y, Sakurai S, Petrova RG, Abedin J, Li H, Yasui K, Takeuchi M, Makita Z, Takasawa S, Okamoto H, Watanabe T, Yamamoto H: Novel splice variants ... in human organs Mod Pathol 2005, 18:1385-1396 Harashima A, Yamamoto Y, Cheng C, Tsuneyama K, Myint KM, Takeuchi A, Yoshimura K, Li H, Watanabe T, Takasawa S, Okamoto H, Yonekura H, Yamamoto H:...
  • 21
  • 626
  • 0
báo cáo hóa học: "Estimation of minimally important differences in EQ-5D utility and VAS scores in cancer" pot

báo cáo hóa học: "Estimation of minimally important differences in EQ-5D utility and VAS scores in cancer" pot

Ngày tải lên : 18/06/2014, 22:20
... beneficial or that would result in a change in treatment [5] Approaches to estimation of MIDs have been classified as either distribution-based or anchor-based [6] Anchor-based approaches compare changes ... a not for profit, tax-exempt corporation that is an alliance of National Cancer Institute (NCI) approved comprehensive cancer centers The CHAMC organizations provide social, emotional and informational ... socio-demographic cancer patient populations All patients who completed the questionnaires consented to participate in the study Institutional review board approval was obtained for secondary data analysis...
  • 8
  • 457
  • 0
Báo cáo hóa học: " Colistin: recent data on pharmacodynamics properties and clinical efficacy in critically ill patients" pot

Báo cáo hóa học: " Colistin: recent data on pharmacodynamics properties and clinical efficacy in critically ill patients" pot

Ngày tải lên : 21/06/2014, 01:20
... caused by gram-negative bacteria Antimicrob Agents Chemother 2009, 53:3430-3436 Daikos GL, Skiada A, Pavleas J, Vafiadi C, Salatas K, Tofas P, Tzanetou K, Markogiannakis A, Thomopoulos G, Vafiadi ... aeruginosa and A baumannii, to improve lung parenchyma penetration Although administration of colistin via inhalation has been adopted and recommended to improve lung parenchyma penetration in the adjunct ... Kontopidou F, Armaganidis A, Cars O, Giamarellou H: Population pharmacokinetic analysis of colistin methanesulfonate and colistin after intravenous administration in critically-ill patients with...
  • 6
  • 329
  • 0
Báo cáo y học: "The Inventory of Personality Organisation: its psychometric properties among student and clinical populations in Japan" pptx

Báo cáo y học: "The Inventory of Personality Organisation: its psychometric properties among student and clinical populations in Japan" pptx

Ngày tải lên : 08/08/2014, 23:21
... Drive, Burnaby, British Columbia, Canada V 5A 1S6, the RQ was translated into Japanese (TK) In accordance with Tanaka et al [42] the Total Attachment Score (TAS) was calculated by subtracting the ... PBI and CATS were distributed to the second subset of students (N = 430) Usable data were available from 374 for paternal Care, 372 for paternal Overprotection, 288 for maternal Care, 283 for maternal ... 37:122-147 Narita K, Shimonaka Y, Nakazato K, Kawaai C, Sato S, Osada Y: Tokuseiteki-jikokouryokukann-shakudo no kenntou: Shougai-haltutatuteki-riyou no kanousei wo saguru [in Japanese] Jap J Educ...
  • 21
  • 442
  • 0

Xem thêm