... center of the tube and the other end was near the tubeÕs downstream end), the tube was evacuated by a mechanical rotary pump to a base pressure of 10À2 Torr The furnace was heated at a rate of ... them have thinner diameters of 5–10 nm A high-magnification TEM image (Fig 1c) shows that the nanowires are remarkably clean and smooth, and there are no particles at its surface An SAED pattern ... image), which is the location of the wafer (indicated by a two-way arrow) It can be seen that the as-grown nanowires on the wafer display well-aligned nature and have length of up to several...
... tagger is a probabilistic program that tags the words in the manual These tags consist of two parts - a mandatory syntactic portion, and an optional semantic portion For example: the word 'cancer' ... Lois; Agarwal, Rajeev; and Davis, Ron (1991) "Disambiguation of prepositional phrases in automatically labeled technical text." In Proceedings of the Ninth National Conference on Artificial Intelligence:l: ... Agarwal, Rajeev; and Davis, Ron (1991) "The automated building and updating ofa knowledge base through the analysis of natural language text." Technical Report MSU-910918, Mississippi State University...
... NTproBNP values above normal plasma levels in cardiac impairment (including NYHA Class I) exceeds the rise of BNP levels This suggests that NT-proBNP may be a more accurate markerof early cardiac dysfunction ... proven to be a good prognostic marker after acutecoronary syndromes or myocardial infarction as well as amarker for patients with chronic heart failure and decreased left-ventricular dysfunction ... had a measuring range from 0.6 to 4130 pg/ml and a functional sensitivity of
... potential of clozapine to cause acute renal failure and the importance of early recognition and treatment As adverse renal events occur rarely, there is a paucity of advice for psychiatrists but ... and information were also provided by Catriona Craigie and Helen Mathews, clinical pharmacists and Dr Jamie Fair of Gartnavel Royal Hospital References Elias TJ, Bannister KM, Clarkson AR, Faull ... Despite advantages for some patients, clinicians need to be aware of the propensity of this drug to cause a wide range of adverse reactions, some of which are quite rare While 10 cases of acute...
... GCGA TCCCAAATGTTTAAGGC 3’) and nested (iCPC - 5’ TTATTAATTGATGGTACAATA 3’, iCPD - 5’ ATCTACGGCAGTAGTATAGTT 3’) primers were used as published (24) µl of DNA was added to reaction mixture containing ... Galita DA, et al Detection of Chlamydia pneumoniae in a bilateral orbital mucosa-associated lymphoid tissue lymphoma American Journal Of Ophthalmology 2006 Jun; 141(6): 1162-3 Carter JD, Gérard ... attempt to evaluate the prevalence of C pneumoniae bacteremia in cardiovascular patients we used a combination of cell culture technique with further evaluation of isolates by PCR That approach...
... N, Awaya Y, Oyama T, Yamakido M, Akiyama M, Inoue Y, Yokoyama A, Hamada H, Fujioka S, Hiwada K: KL-6, a mucin-like glycoprotein, in bronchoalveolar lavage fluid from patients with interstitial ... sure of the cellular source of plasma KL-6 This uncertainty could potentially be important as it may limit the potential utility of plasma KL-6 as amarkerof lung epithelial damage in ARDS Conclusion ... was measured by ELISA (Eisai Corporation, Tokyo, Japan) according to the manufacturer's instructions in BALF and in plasma The intra-assay coefficient of variation was 5.1% and the inter-assay...
... 51:189-197 A ssaoui Y, Zeggwagh AA, Zekraoui A, Abidi K, Abouqal R: Validation ofa behavioral pain scale in critically ill, sedated, and mechanically ventilated patients Anesth Analg 2005, 101:1470-1476 ... presented as the mean ± standard deviation for variables with a normal distribution, and as the median and interquartile range for variables with skewed distributions Parametric or nonparametric ... of data NM helped to draft the manuscript, and participated in the acquisi- Page of 10 (page number not for citation purposes) tion of data AZ participated in the coordination of the study AAZ...
... recreate again: this relapse could promote the formation ofa layer of reactive collagen in the region below the treated area We therefore believe that this technique can be utilized as asimple and ... of this patient All the authors read and approved the final manuscript CONSENT STATEMENT Written informed consent was obtained from the patient for publication of this case report and accompanying ... Monocril 2-3/0 are made with a large needle and are placed close together so that a wide aversion is achieved at the margins of the scar and a deep wound closure is obtained by adhering to the...
... was stronger among men (OR=3.13) than among women (OR=2.19) (Table 2) Additional analysis treating days of sickness absence during 1990 as a continuous variable showed a clear trend of increase ... considerably younger than the official retirement age, and to ensure a maximum age of 59 during follow-up: Alternative labour market exit options in terms of voluntary early retirement is available ... Ministry of Employment, the Ministry of Social Affairs and the Ministry of Education DWECS was conducted in 1990, and featured a random sample drawn from the Central Population Register of Denmark of...
... These data suggest that hypoalbuminaemia can be more appropriately viewed as a composite marker which reflects malnutrition as well as increased acute phase inflammation, considering that albumin ... The authors have declared that no conflict of interest exists References Renal Data System USRDS 2003 annual data report: atlas of end-stage renal disease in the United States Bethesda: National ... intervals All analyses were conducted with the use of STATVIEW software RESULTS The patients included 52% male and 48% female, 85% white and 15% black and mean age was 57 years The majority of patients...
... use as an order parameter The vertical orientation ofa grain thus wastes space proportional to − a, relative to the horizontal one We examine the response of the packing fraction for typical parameter ... density may attain values that are substantially higher than random close packing, and quite close to the crystalline limit [131, 132] An analogous transition has also been observed experimentally ... implies that the grain is nearly square (a ∼ 1), and any grain flip is easily reversed by a corresponding flop! Generalising once again, we suggest that where grains are symmetrically shaped and the...
... Ngoại giao Consular Agent An official doing consular work for a nation in a locality where it does not maintain a regular consulate This official is usually a national of his host state, and his ... "cultural attaché", etc On the military side, an embassy will generally have either an army attaché, naval attaché, or air attaché – and often all three In American embassies, the senior of the ... name In Vietnamese: Sự đồng thuận Ambassadress A term often used to denote the wife of an ambassador, and misused to denote a woman chief of mission The latter is an ambassador, not an ambassadress...
... systems, and from here on we use the ratio of acid phosphatase activities as an indicator of gene length-dependent accumulation of mRNA (GLAM) Reduced GLAM ratios in transcription-elongation mutants ... mutants affecting subunits of SAGA Both gcn5D, a mutant lacking the histone acetyltransferase present in SAGA, and spt3D showed reduced GLAM ratios (Fig 5A) As this result suggests a role of SAGA ... probably due to differences in mRNA extraction and ⁄ or mRNA transfer during blotting We concluded that measurement of acid phosphatase activity was the best estimation of the mRNA abundance...
... levels of aspartate damage that are typical ofa much older normal erythrocyte population Exposure to certain foods or drugs (fava beans, nonsteroidal anti-inflammatory drugs, antimalaria drugs, ... the isoaspartate content of intracellular proteins is increased as the result of heat shock [33] as well as of UVA irradiation [34] As far as the Fig Schematic representation of the overall hypothesis ... before and not as a consequence of massive alterations of membrane protein composition The results indicate that protein damage at the aspartate level is a sensitive and early markerof erythrocyte...
... Strickland and Joan Woods, USAID, Washington, DC, USA V Chandra-Mouli, Child and Adolescent Health, WHO/HQ, Geneva, Switzerland Charles Gollmar, CDC, Atlanta, GA, USA Delia Barcelona, UNFPA/Headquarters, ... rates; and available methods of contraception - analyse a variety of potential situations for sexual interaction and determine a variety of actions they may take and the consequences of such actions ... agreements Advocating with accurate and timely data can convince national leaders and communities that prevention from an early age is important It can also help ensure that programmes focus on the actual...
... scheme, and allows the assessment of the contribution of biogeochemically available trace metals to the total particulate metal concentration in SPM Materials and methods 2.1 Reagents and labware All ... was calculated as: Percentage OC 100 A B A (1) 2.3 Use of EDTA as extractant The interaction between an added chelating ligand and metals complexed by naturally occurring ligands in the aquatic ... Whitworth et al / Analytica Chimica Acta 392 (1999) 3±17 mation about the biogeochemical availability of the particulate matter associated trace metals For soils and sediments, workers have employed...
... purified apoA-II also displayed bacteriostatic activity against the Gram-positive and -negative bacteria at micromolar concentrations (Table 1) These results clearly show that although apoA-I seems ... as in (A) (E) Western blot analysis of the gel in (D) using a specific anti-apoA-II serum Fig 4B, the intact apoA-I (band a) , an intermediary fragment (band b) and a more stable third band (band ... Krauskopf, M., Amthauer, R., Araya, A. , Concha, M.I., Leon, G., Rios, L., Vera, M & Villanueva, J (1988) Temperature acclimatization of the carp Cellular and molecular aspects of the compensatory...
... Hatayama, T (1999) Molecular cloning, expression and localization of human 105 kDa heat shock protein, Hsp105 Biochim Biophys Acta 1444, 138–142 16 Yasuda, K., Nakai, A. , Hatayama, T & Nagata, ... that SA induced the activation of HSF, the transcription of hsp genes and the accumulation of Hsps in various mammalian cells and a concomitant increase of thermoresistance of cells Thus, SA may ... such as Hsp10 5a and Hsp70 in various mammalian cells Enhancement of thermoresistance of cells by SA Upon exposure to a sublethal heat treatment, mammalian cells acquire transient resistance to a...
... goethite and Amaratunga, G A J Growth and process conditions of natural hematite: Can Raman spectroscopy be used to aligned and patternable films of iron(III) oxide nanowires differentiate them? ... providing a higher temperature gradient across the wire compared to that obtained with conventional furnace oxidation techniques Another important reason is the presence of water and CO2 in ambient air, ... One-dimensional ZnS nanomaterials G.; Zhu, Y Q Growth and characterization of iron oxide and nanostructures J Mater Sci Technol 2006, 22, nanorods/nanobelts prepared by asimple iron-water 721 reaction...