application of a gis based statistical method to assess spatio temporal changes in breast cancer clustering in the northeastern united states
Báo cáo khoa học: " Application of a population-based severity scoring system to individual patients results in frequent misclassification" doc
Ngày tải lên :
12/08/2014, 22:22
... determination The study coordinators came from individual participant sites in the ADDRESS trial and were either employees or associates of the principal investigators at those sites The clinical ... confidence in the accuracy of real-world APACHE II scores In studies where the accuracy of an individual APACHE II determination is the main focus of attention, the number of cases that can be studied ... of death, an individual score could not be translated into a specific risk of death without taking into account the underlying diagnosis [1] Thus in a large group of patients, all with an APACHE...
- 8
- 241
- 0
báo cáo hóa học:" Application of a disease-specific mapping function to estimate utility gains with effective treatment of schizophrenia" pot
Ngày tải lên :
20/06/2014, 15:20
... appears to have greater precision than a SF-36 -based mapping function One of the greatest advantages of the diseasespecific mapping function is that it uses data generally available in clinical ... other mental illnesses In this paper, we describe the application of a disease-specific utility mapping function based on the PANSS, incorporating an additional assessment of the impact of adverse ... responsiveness of the utility mapping function, we applied it to data from an open-label, international (Europe and Canada), 50-week trial evaluating the long-term safety and tolerability of long-acting...
- 8
- 374
- 0
báo cáo khoa học: " A group randomized trial of a complexity-based organizational intervention to improve risk factors for diabetes complications in primary care settings: study protocol" ppsx
Ngày tải lên :
11/08/2014, 05:22
... understanding of clinician, staff, and patient perception of their goals and performance [35] Separately, the facilitator will gather data using a standardized medical record review form to obtain ... examine the relationship between implementation of the CCM and communication among staff and clinicians; and 3) to advance the science of translational research in primary care settings by examining ... reorganize based upon nonlinear interactions [21] The ability of a CAS to adapt in a manner that allows for change or improvement can be enhanced by improving the quality and quantity (bandwidth) of...
- 7
- 319
- 0
Báo cáo y học: "Application of a diagnosis-based clinical decision guide in patients with neck pain" doc
Ngày tải lên :
13/08/2014, 15:21
... commencing data gathering on the application of the DBCDG This occurred in the form of monthly clinical meetings in which the application of the DBCDG in particular patients was discussed as well as ... 2) In many cases, the working diagnosis is multifactorial, leading to a multi-modal management strategy Page of 10 In seeking an answer to the first question of diagnosis, standard history and ... developments in the literature related to the evaluation and management of patients with NP History and examination were performed according to the usual course of patient care at the Rhode Island Spine...
- 10
- 356
- 0
Báo cáo y học: "Application of a Diagnosis-Based Clinical Decision Guide in Patients with Low Back Pain" pdf
Ngày tải lên :
13/08/2014, 15:21
... hours of postgraduate training in manual therapy Several discussions between the examiners took place over the course of five years prior to commencing data gathering on the application of the ... score was also recorded Treatments Treatment was left to the discretion of the primary treating clinician based on the diagnosis, and in general a “team approach” was taken In the context of the ... benefit to the patient [16] However little information is available on the relative efficacy of any particular systematic approach to applying the biopsychosocial model in clinical practice A diagnosis-based...
- 33
- 395
- 0
Application of competency gap based training method at power engineering consulting joint stock company 3
Ngày tải lên :
25/11/2014, 00:36
... the overall human resource management and training of company - Application the competency gaps based training method to training in PECC3 Data collection method The data thesis collection methods ... throughout the world with national systems of vocational trainings in England and Wales, with national qualification framework in New Zealand, the National Training Board in Australia CHAPTER 1: THEORETICAL ... the training in Chapters and of the thesis CHAPTER 2: THE SITUATION OF TRAINING AT POWER ENGINEERING CONSULTING JOINT STOCK COMPANY 18 CHAPTER 2: THE SITUATION OF TRAINING AT POWER ENGINEERING...
- 98
- 945
- 0
An application of a discourse-based approach in teaching English skill at Thanh Hoa Vocational School of Commerce – Tourism = Ứng dụng phương pháp tiếp cận dựa
Ngày tải lên :
28/03/2015, 09:26
... This paper was aimed at studying the effectiveness of the application of discourse -based approach in teaching reading skill to improve the effectiveness of teaching and learning reading at Thanh ... reason, so that, if, unless, otherwise, in that case… Step 5: Evaluation (Collecting data again and analyze it to work out the findings) To evaluate the effectiveness of the application of a ... mentally ‗sound out‘ to enable the reader to identify the words that they make up; words are chained together to form sentences and sentences are linked together into paragraphs; and finally paragraphs...
- 66
- 704
- 0
Development and application of a web based kanban system
Ngày tải lên :
04/10/2015, 15:45
... enhance their manufacturing system and operations The major advantages of a Web -based Kanban system is the availability of visible and real-time information within the manufacturing operations as ... withdrawal Kanban except that that the retrieval of Subcontract Kanban materials is from a factory or storage location near the actual manufacturing plant Express Kanban Auxiliary Kanban Issued ... manufacturing, the withdrawal kanban attached to the box is removed and placed on the Kanban container (2) When a withdrawal kanban is present in the kanban container, the material handler that...
- 78
- 391
- 1
Development and application of mass spectrometry based proteomics technologies to decipher ku70 functions
Ngày tải lên :
04/10/2015, 15:46
... death signals in mammalian cells (Sawada et al., 200 3a) By screening a human cDNA library to identify inhibitors of Bax, Sawada et al (Sawada et al., 2003b) identified the Bax-binding and Bax inhibiting ... IgG-binding domain of protein A of Staphylococcus aureus (ProtA) and calmodulin-binding peptide (CBP) are inserted into a vector The protein of interest is fused to the TAP tag and expressed in the ... 20 are known Ku70 interacting proteins, they function mainly in DNA repairs and telomeric maintenance Others are mainly cytosolic proteins that are classified to be apoptotic regulatory proteins...
- 168
- 472
- 0
báo cáo khoa học: " Identification of a GCC transcription factor responding to fruit colour change events in citrus through the transcriptomic analyses of two mutants" potx
Ngày tải lên :
11/08/2014, 11:21
... ctttacgattataattatgtcgacagagatggtgttagaaaaggattaattgtagtttat 781 tgacaacataatcacaagaaaaacaaaaatgattgtagtaataatttaatttttttcttt 841 ccccaacaaaacctcaatgatacaaaagaattttaataaaaaaaaaaaaaaaaaaaaaaa 61 ... L Q L Q L E L E aagcatcttcatgatcaattagagatgcaaatgaatttacaaaagctgattgaggatcaa K H L H D Q L E M Q M N L Q K L I E D Q gggaagcaggtgaagatgatgttagagaagcaattaaaatcaaaccagaaataatttgag G K Q V K M M ... F V E C V N cgccttggaggttctgagaaggcaacaccaaaggcgatactgaaactgatgaaatcgaaa R L G G S E K A T P K A I L K L M K S K gaattgagtatcctacaagtaaaaagtcatttgcagaaatatcgatccgagaagctcata E L S I L Q V K S...
- 14
- 400
- 0
Báo cáo y học: "Validation of a new transpulmonary thermodilution system to assess global enddiastolic volume and extravascular lung wate" pptx
Ngày tải lên :
14/08/2014, 07:21
... respiratory rate between 12 and 16 breaths/minute (to maintain an end-expiratory partial pressure of carbon dioxide within the normal range), a positive end-expiratory pressure of cmH2O and a tidal ... necessary to maintain MAP >50 mmHg and continuous CO >5 l/minute as long as possible When it was no longer possible to maintain SaO2 > 90% and MAP >50 mmHg, data collection was stopped and animals ... changes in cardiac preload are induced by bleeding and fluid loading They also confirm that GEDV is not affected by dobutamine-induced changes in CO, and hence that there is no mathematical CO2...
- 8
- 285
- 0
Development of a Regional Risk Management Framework for APEC Economies for use in the Control and Prevention of Introduced Marine Pests
Ngày tải lên :
28/10/2013, 11:15
... Priorities and hazards for Economies Variable levels of activity and management capability Ships’ ballast water and hull fouling are the most important vectors International shipping, aquaculture ... a role in liaising with IMO, FAO, NACA to enhance the effectiveness of existing instruments within APEC Institutional arrangements for managing the marine environment is fragmented in most ... Framework Conclusions, including the results of the November 2001 Workshop Management Framework - Introd uced Marine Pests Management capabilities and approaches APEC and the MRCWG have a...
- 10
- 583
- 0
Chronicles of a Dallas Cowboys Fan: Growing Up With America''''s Team in the 1960''''s by John Eisenberg pptx
Ngày tải lên :
14/03/2014, 17:20
... roster The Southwest Conference was not integrated, and the idea of paying to watch blacks play football sat uneasily in many fans‘ minds Within days of the announcement that the team was coming, a ... played at Turnpike Stadium in Arlington A minor league hockey team, the Blackhawks, played at the State Fair Coliseum to small crowds of displaced hockey nuts The Chaparrals, of the American Basketball ... faithfully to the SMU games, the Texas-Oklahoma games, and the Cotton Bowl games But college football was a fading light in Dallas when I came of age as a sports fan The Cowboys began to shine;...
- 18
- 466
- 0
báo cáo hóa học: " The effects of a graduated aerobic exercise programme on cardiovascular disease risk factors in the NHS workplace: a randomised controlled trial" pdf
Ngày tải lên :
20/06/2014, 00:20
... TA, Mensah GA, Alexander RW, Anderson JL, Cannon RO, Criqui M: Markers of inflammation and cardiovascular disease: application to clinical and public health practice: A statement for healthcare ... exercise training programme was provided, and participants were instructed to maintain the exercise as of week for the final weeks This was to evaluate if there was any further physiological benefit, ... testing, performed statistical testing and drafted the manuscript MM carried out the immunoassays GPW participated in the coordination of the study and drafting of the manuscript KvS helped to...
- 10
- 662
- 0
Báo cáo lâm nghiệp:"Growth and biomass partitioning of Fagus sylvatica L. and Quercus robur L. seedlings in response to shading and small changes in the R/FR-ratio of radiation" pot
Ngày tải lên :
08/08/2014, 01:21
... fargesii and by Wiebel et al [53] for Garcinia mangostana In addition, an increasing number of branches of young Quercus petraea and an increasing length growth of these branches with increasing ... volume index VB (product of branch length and the square of the diameter at branch base (in cm respectively)) and the dry mass of the branch (DMbranch) that was calculated using the branches of a ... (length) of the main stem (mm), diameter (tenth of a mm) of main stem collar at a permanently marked position cm above the substrate surface, diameter (tenth of a mm) of the main stem at the half...
- 9
- 341
- 0
Assessment of weed management practices and problem weeds in the midsouth united states—soybean a consultants perspective
Ngày tải lên :
04/09/2015, 08:07
... Palmer amaranth in Arkansas (Arkansas soybean growers personal communication), and total hand-weeding cost can vary based on the level of infestation and the frequency of hand-weeding Palmer amaranth ... remaining scouted area, the LL soybean system was used in Table Questionnaire on the spread and management of glyphosate-resistant Palmer amaranth .a a Data in acres were converted to hectares Arkansas ... percentage of total scouted area infested with glyphosate-resistant Palmer amaranth was 16% in Louisiana, compared with 54% in the remaining midsouth The first case of glyphosate-resistant Palmer amaranth...
- 12
- 556
- 0
university press of florida archaeological studies of gender in the southeastern united states mar 2001
Ngày tải lên :
11/06/2014, 13:10
... chemistry may mean that past interpretations may not be valid Maintaining access to skeletal material is clearly important for 22 Claassen the study of social organization The accessibility of DNA in ... subdivided into those activities relating to acquiring and processing food; making and repairing tools, clothing, and buildings; and maintaining social relations For each step in an activity, ... archaeologists and physical anthropologists who assign sex to skeletons to think that that act is purely the application of a biological label and not a cultural act In fact, what we in sexing skeletons...
- 241
- 318
- 0
Báo cáo lâm nghiệp: "Distribution, historical development and ecophysiological attributes of oak species in the eastern United States " pdf
Ngày tải lên :
08/08/2014, 18:21
... from a low of 43 cm in North Dakota to a high of 140 cm in Louisiana Growing season length varies from 90 days in the upper Great Lake States to 300 days in the southeastern Coastal Plain Eastern ... Pennsylvania through West Virginia and into the Cumberland Mountains of Kentucky and Tennessee (fig 1).Aesculus octandra, Tilia heterophylla and Magnolia acuminata are characteristic indicator species ... European settlement, tallgrass prairie and oak savannas dominated vast Southern evergreen This vegetation association is confined to the southeastern Coastal Plain from Virginia to the Gulf Coastal...
- 26
- 314
- 0
Báo cáo y học: "No evidence of XMRV in prostate cancer cohorts in the Midwestern United States" potx
Ngày tải lên :
13/08/2014, 01:20
... genotype was determined by nested PCR amplification using outer primers 5’-CTGGGGTTCTATGAGAAGCAAG-3’ and 5’-TGAGCTTTCAGATCCTC AAATG-3’, and inner primers 5’-GAGAGAACAGTCACTTGGTGAC-3’ and 5’-CAGCCCACTTGATGCTC ... outer gag: 5’-ACGAGTT CGTATTCCCGGCCGCA-3’ and 5’-CCGCCTCTTCT TCATTGTTC-3’, primers for inner gag: 5’-GCCCATT CTGTATCAGTTAA-3’ and 5’-AGAGGGTAAGGGCAGGGTAA-3’) with platinum Taq polymerase (Cat no ... levels of mouse mitochondrial or endogenous retroelements (IAPs) Together with our data, these findings highlight the difficulty of avoiding DNA contamination in clinical samples and the risk of...
- 11
- 566
- 0
A Knowledge-Based Approach to Network Security: Applying Cyc in the Domain of Network Risk Assessment pptx
Ngày tải lên :
05/03/2014, 23:20
... 95/98/NT/2000/XP, Linux RedHat and Solaris The Attack Planner enables the user to state plan goals, launch the planner and view the attack plans generated For example, a user can state the goal “An external ... server translates the information returned by the Sentinels into CycL and adds it to the KB This approach is potentially vulnerable to an attack on the Sentinels themselves, or to spoofing of their ... that gathers information about the software, hardware and status of the machine it is running on The server polls the Sentinels, gathers network information from them, and then represents that...
- 6
- 490
- 0