any other circumstance of a substantive nature affecting items of property plant and equipment such as leases insurance litigation attachments and similar situations
Báo cáo khoa hoc:" A review on SNP and other types of molecular markers and their use in animal genetics" ppt
Ngày tải lên :
09/08/2014, 18:21
... A Vignal et al Genomic DNA from genetically distant individuals Excise, clone in plasmid Mixing, restriction digestion Sequence library ACGTGAATTCACTAG ACGTGAATTCACTAG ACGTGAACTCACTAG ACGTGAATTCACTAG ... especially in random approaches such as RRS and the comparison of EST sequences This can be partially overcome for species in which databases of repeated elements are available, that can be used ... throughput that might reach those of MALDI-TOF It also has the great advantage of generating a complete short sequence stretch of about 50 base pairs, instead of just one genotype at a single base SNPS...
- 31
- 595
- 0
Báo cáo khoa học: The twin-arginine translocation (Tat) systems from Bacillus subtilis display a conserved mode of complex organization and similar substrate recognition requirements doc
Ngày tải lên :
16/03/2014, 04:20
... GTGAGTCGCAAAGGTTTGGTAAAAACG) and RKDmsAR (CGTTTTTACCAAACCTTTGCGACTCACCTC AGCAGC) for RK mutation; and KRtoKKDmsAF (GCTGAGGTGAGTAAAAAGGGTTTGGTAAAAACG ACAGCG) and KRtoKKDmsAR (CGCTGTCGTTT TTACCAAACCCTTTTTACTCACCTCAGC) ... chromosomal DNA with primers RTEAyF (5¢-CGCGTCTCGCATGCCGATCGGTCCTGGAAGCCT TGCTG-3¢) and JJystrep02 (5¢-ATATTCTAGATTATTT TTCAAACTGTGGGTGCGACCAATTCGATTGCCCAG AAGACACGTCCCG-3¢) RTEAyF was designed as such ... GAATTCACCATTATGAGCACTTTTA) and PCR_AmiA_EcoRI_rev (GGCCGAATTCGCTGTGTCCGTTGCTG GTT) for AmiA, and PCR_MdoD_EcoRI_for (GGCCGA ATTCACCATTATGGATCGTAGAC) and PCR_MdoD_EcoRI rev (GGCCCAATTCGTCAAAACGCTGGGTT...
- 12
- 445
- 0
Source investigation of a small event using empirical Green’s functions and simulated annealing ppt
Ngày tải lên :
23/03/2014, 13:20
... active area on the fault This gives us values of the average total slip of between 0.1 and cm and a stress drop of between I and 10 bar for a rise time equal to At, and a stress drop that can reach ... iaround 0.1, and the number of iterations at a constant temperature equal to 10 This gives a good estimate of the average energy and the standard deviation Another problem that has to be solved ... scale For each of the two possible fault planes, the active fracture area has a different shape Fig shows a rupture propagation towards the north-north-east for the two fault planes The shape and...
- 13
- 486
- 0
Tài liệu Application of Genetic Algorithms and Simulated Annealing in Process Planning Optimization pptx
Ngày tải lên :
25/12/2013, 19:15
... features A and B, machining either one first may partially create the other If machining A has a larger material removal rate (e.g., an endmall cutter with a larger diameter) than machining B, A ... algorithm (GA) is a stochastic search technique based on the mechanism of natural selection and natural genetics It starts with a set of random solutions called population, and each individual ... 9.4 An example part and specifications MCI = 50), and one CNC horizontal milling machine (M5, MCI = 85) It is assumed that all the machines are capable of accommodating the part The available...
- 27
- 514
- 0
Báo cáo khoa học: "Transformation-based Interpretation of Implicit Parallel Structures: Reconstructing the meaning of vice versa and similar linguistic operators" doc
Ngày tải lên :
31/03/2014, 01:20
... “external” and “internal” may be swapped (Modifier), or the whole NPs “external policy” and “internal policy” (Argument) Lex means that none of the patterns was applicable and a lexical paraphrase (such ... Case2 (x, z) ∧ Case(z, v) → Swap(x, u, v, xp ) Recast optional case as head of an obligatory P red(x) ∧ Case1 (x, u) ∧ Case2 (x, v) ∧ T ype(u, tu) ∧ T ype(v, tv)∧ Recastable(tv, Case2 , tu, Case3 ... transformation needed is of purely lexical nature, such as turning “augment” into “reduce”, and instances of andersrum as expressing a purely physical change, such as altering the orientation of...
- 8
- 299
- 0
A study on wireless hearing aids system configuration and simulation
Ngày tải lên :
26/09/2015, 10:43
... combination of a digital-to-analog converter (DAC) and an anti-aliasing filter and output through a speaker 15 Fig 2.7 Analog hearing aid block diagram Fig 2.8 Digital hearing aid block diagram 2.2.2 ... directional microphone and non-linear compression have appeared Digital hearing aids became commercially available at the 1990’s With the advanced DSP technology, features such as adaptive filtering, ... interaural delay that arises from spatial separation of the ears is largely sufficient for providing signal detection and speech reception advantages The received audio signal can also be separated...
- 97
- 399
- 0
Would a Roshanda by Any Other name smell as sweet
Ngày tải lên :
17/10/2013, 18:20
... Girl Names Sarah Emily Jessica * See note, p 303 174 Lauren Ashley Amanda A Roshanda by Any Other Name Megan Samantha Hannah 10 Rachel 11 Nicole 12 Taylor 13 Elizabeth 14 Katherine 15 Madison ... brand names (Lexus, Armani, Bacardi, Timberland) and what might be called aspirational names The California data show eight Harvards born during the 1990s (all of them black), fifteen Yales (all ... 17 Alexandra 18 Brittany 19 Danielle 20 Rebecca Most Common Low-Income White Girl Names Ashley Jessica Amanda Samantha Brittany Sarah Kayla Amber Megan 10 Taylor 11 Emily 12 Nicole 13 Elizabeth...
- 26
- 589
- 0
Tài liệu Báo cáo khoa học: Solution structure of crotamine, a Na+ channel affecting toxin from Crotalus durissus terrificus venom docx
Ngày tải lên :
20/02/2014, 11:20
... heavy (line) atoms ˚ residual distance violations not greater than 0.5 A and dihedral violations not more than 5° As already suggested by previous studies [37,38] the molecule has a flat shape and ... mean rmsd values from the ˚ idealized covalent bond (0.002 A) and covalent angles (0.90°) indicate the absence of stereochemical distortions An assessment of the local variability of backbone and ... from snake venom active on Na+ channel Materials and methods Isolation of crotamine Native crotamine was isolated and purified from the yellow venom of the snake Crotalus durissus terrificus as described...
- 11
- 460
- 0
A RIP VAN WINKLE OF THE KALAHARI AND OTHER TALES OF SOUTH-WEST AFRICA doc
Ngày tải lên :
06/03/2014, 03:21
... borderland between Klein Namaqualand, and Gordonia, Cape Colony, and what was at that time known as German South- West Africa Four of them appeared a few years back in The State an illustrated magazine ... scarce be able to struggle back to the nearest t'samma we had left, and in any case, to go back, beaten! No, if Inyati gave any hope at all, I would push on as long as life lasted So I lay and ... however, was useless to us, as our way was east or north-east, and in this direction all Inyati's reconnoitering failed to discover anything but bare dunes, as far as the eye could reach Pleasant as...
- 160
- 619
- 1
Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf
Ngày tải lên :
07/03/2014, 05:20
... TGGACGGATATTGAAGCTGATCTCACCATAAAGGAT ATCCTTTATGGTGAGATCAGCTTCAATATCCGTCCA TTAAAGGCTATCAAATCGCAAGAACAGTTCACTAGA TCTAGTGAACTGTTCTTGCGATTTGATAGCCTTTAA GAAGCAAGAACAGTTCACTTAGTCAATTGATTAACGTG CACGTTAATCAATTGACTAAGTGAACTGTTCTTGCTTC ... sheets and 8, the AAA domain helix and the C-terminal helix) However, the majority of these proteins are likely to be other meiotic clade AAA ATPases and have the AAA domain helix and the C-terminal ... currently aimed at achieving a detailed understanding of the roles of the numerous components of the MVB sorting machinery Vps4 is an ATPase of the AAA (ATPase associated with a variety of cellular activities)...
- 23
- 490
- 0
Comparison of composition (nutrients and other substances) of organically and conventionally produced foodstuffs: a systematic review of the available literature doc
Ngày tải lên :
28/03/2014, 19:20
... Unobtainable paper Unobtainable paper Unobtainable paper Unobtainable paper Unobtainable paper Unobtainable paper Unobtainable paper Unobtainable paper Unobtainable paper Unobtainable paper Unobtainable ... compounds and Flavonoids • Strength of evidence Phenolic compounds all available data: Phenolic compounds satisfactory quality data: Flavonoids all available data: Flavonoids satisfactory quality data: ... studies may have been lost These analysis and interpretation decisions were applied as the review was designed to make the best use of all available data and to present the data in a standardised...
- 209
- 726
- 0
A Romance of Canvas Town and Other Stories pptx
Ngày tải lên :
30/03/2014, 15:20
... us about, gave and took a good deal of banging before any one was killed outright, like Sir Albany Fetherstonhaugh in the ballad; he had odds against him too 15 A Romance of Canvas Town and Other ... countenance and ludicrously important as the bearer of a tale of woe 16 A Romance of Canvas Town and Other Stories ‘How many sheep have you lost?‘ bluntly demands Hobbie ‘Bin and ‘ad a smash, sir,‘ ... within a neatly paled enclosure rested the ordinary station casualties: A drowned sheep-washer; a horse-breaker taken unawares, and ‘smashed‘ by a savage mustang; a nameless wayfarer who had prolonged...
- 257
- 216
- 0
a memoir of jane austen and other family recollections dec 2002
Ngày tải lên :
11/06/2014, 05:27
... her great news in the hall (to Jane and Martha Lloyd, the two aunts who had been away, and not to Jane and Cassandra, as is here implied) There was also another version, recorded by Fanny Caroline ... of Aunt Jane than Lady Knatchbull’ (see pp –) But in the same place Anna also writes that Fanny’s family, the Knights of Godmersham, felt a general preference for Cassandra Austen and that ... well as its reverent colouring, are owed, in one way or another, to Cassandra Austen The closeness of the relationship between Jane and Cassandra has been the subject of much speculation among...
- 352
- 296
- 0
Báo cáo lâm nghiệp: " Growth of wild cherry (Prunus avium L.) in a mixture with other species in a demonstration forest" ppsx
Ngày tải lên :
07/08/2014, 03:22
... lime and alder (in accordance with their share of BA) Basic data on the stand species composition and mean stem are given in Table Average stand height is about 21 m, which is reached by stand-forming ... well as its capacity to keep its position in a stand MATERIAL AND METHODS A large stand with wild cherry trees as a standforming species in the area of Demonstration Forests in Kostelec nad Černými ... the nearest 0.5 m), size of the crown (vertically and horizontally) and tree class evaluation (according to Konšel’s classification) The stand is at an altitude of about 350 m above sea level;...
- 6
- 357
- 0
Báo cáo toán học: "Periodicity and Other Structure in a Colorful Family of Nim-like Arrays" pdf
Ngày tải lên :
08/08/2014, 12:22
... verify that a change of seed from to has a minimal effect; other than the top left × block, the pattern of the array A1 is exactly the same as that of A0 The array A0 is well known as the Nim addition ... thus As and its subarrays may be viewed as two-dimensional words over the alphabet of nonnegative integers, and its rows and columns as onedimensional words A fundamental notion in the study of ... that Nimaddition may be represented as a recursively generated array [4] The purpose of this paper is to give a detailed combinatorial and graphical description of the members of a family A ...
- 21
- 298
- 0
báo cáo khoa học: "Brachypodium distachyon: a new pathosystem to study Fusarium head blight and other Fusarium diseases of wheat" pdf
Ngày tải lên :
11/08/2014, 11:20
... spray and point inoculations, disease assessments and detached leaf assays and normal light and SEM microscopy analysis GB carried out Bd root inoculations and CLSM analysis of root tissues and participated ... hyphal strands enveloping the base of the macro-hair, intense phenolic compound accumulation and collapse of the macro-hair o-p) External surface of the palea showing the base of a macro-hair and ... Theoretical and Applied Genetics 2010, 121:147-156 Amatulli MT, Spadaro D, Gullino ML, Garibaldi A: Molecular identification of Fusarium spp associated with bakanae disease of rice in italy and assessment...
- 14
- 342
- 0
Báo cáo y học: "The Autism - Tics, AD/HD and other Comorbidities inventory (A-TAC): further validation of a telephone interview for epidemiological research" docx
Ngày tải lên :
11/08/2014, 17:20
... conceiving and designing the study, and statistical analyses CaG in designing the study, collecting data and performing clinical assessments OS and EC in collecting data and statistical analyses BK and ... specifically in relation to ASD symptomatology and associated problems, and (c) in that it has been validated as a telephone interview There are today several instruments that are frequently used as ... preliminary version of the A- TAC (with 178 items) had “excellent” screening properties for AD/HD and ASD (as assessed by areas under receiver operating characteristics curves around 0.90), and “fair”...
- 11
- 377
- 0
Analysis of transport phenomena and electrochemical reactions in a micro PEM fuel cell with nature inspired flow field design
Ngày tải lên :
09/09/2015, 10:17
... conditions are applied at the land area (interface between the bipolar plates and the gas diffusion layers) Neumann boundary conditions are applied at the interface between the gas channels and the gas ... conditions Boundary conditions are specified at all external boundaries of the computational domain as well as boundaries for various mass and scalar equations inside the computational domain 2.3.1 ... the same as the gas phase temperature 2.2.2 Gas diffusion layers The physics of multiple phases through a porous medium is further complicated here with phase change and the sources and sinks associated...
- 16
- 365
- 0
Báo cáo khoa học: " Medication errors: a prospective cohort study of hand-written and computerised physician order entry in the intensive care unit"
Ngày tải lên :
25/10/2012, 10:39
... harm or an increase in patient monitoring with no change in vital signs and no harm noted Moderate errors were classified as those causing an increase in patient monitoring, a change in vital ... intensive care unit JAMA 1999, 282:267-270 British Medical Association and the Royal Pharmaceutical Society of Great Britain: British National Formulary March edition London; 2003 National Coordinating ... rate analysis The patient outcome from each error were assigned by the pharmacist and the ICU clinical director, according to an adapted scale [9-11] Minor errors were classified as those causing...
- 6
- 526
- 0