... unstable annular alternating flow (LUAAF), liquid/annular alternating flow (LAAF), and annular flow The observed flow patterns ina 0.22-mm-diameter channel include throat-annular flow, annular ... interaction Although the data points are in laminar–laminar flow, they cover different flow patterns such as bubble, stratified, and annular As the mass flow rate of the gas in two-phase flow increases, ... expressed in terms of the asymptotic single- phase frictional pressure gradients for liquid and gas flowing alone Asymptotes appear in many engineering problems, such as steady and unsteady internal and...
... dramatic astronomical phenomena, has also stimulated much important research Some have interesting mathematical implications, involving particular types of mathematical argumentations, such as the involvement ... y a Topolog´ Facultad de Ciencias a, Universidad de Granada Avenida Fuentenueva s/n E-18071 Granada, Spain sanchezm@ugr.es Olivier Sarbach Department of Physics & Astronomy Louisiana State ... Emch and Galloway were eager to pass from this established arena and some more exotic things like add dust to the basic model Galloway even explained how Frankel’s approach [40] to the Raychaudhuri...
... Creep Analysis of Engineering Materials, Mechanical Properties of Engineering Materials, Control and Stability of Mechanical Application, Damage (Crack and Delamination Analysis) and other mechanical ... Method Based on Micromechanical model’ International Journal of Engineering, Business and Enterprise Applications (IJEBEA), 2013 [3] Mostapha Raki, Reza Alipour and Amirabbas Kamanbedast ‘Thermal ... Muhannad Al-Waily, Lecturer at Mechanical Engineering Department, Faculty of Engineering, AlKufa University Ph.D In Mechanical Engineering/College of Engineering/Alnahrain University/Iraq Specialization:...
... well as analytically in terms of nonlinear Bloch waves The development and disappearance of a self-trapped state is observed Such dynamical selftrapping can be well explained by the nonlinear band ... potential in particular In this case, the ground state may not be a symmetric state, which is in contrast to a BEC with repulsive interaction Applying a Gaussian wavepacket ansatz to the GPE, a critical ... with analytically studying the ground state of asingle component BEC in several types of trapping potential, for both repulsively and attractively interacting atoms (Chapter 2) In Chapter 3, accurate...
... varying bottom topography toward the predominant shallow Sunda Shelf which acts as a separator of two deep basins (South China Sea/Pacific Ocean and Andaman Sea/Indian Ocean) and the complicated ... oceans (Indian, mainly semi-diurnal; and Pacific, mainly diurnal) It is further complicated by factors such as persistent basin-scale monsoon winds over the South China Sea and Andaman Sea, sharply ... variations (tidal and non-tidal) are the main cause of a large fraction of the variance in many oceanographic variables For many practical applications in the marine environment (e.g ship navigation,...
... hypertension also lead to elevated intrarenal RI If blood pressureand heart flow are stable, an increase in heart level causes intrarenal RI to fall Tachycardia also leads to a fall in intrarenal RI (Shokeir ... similar to those in the abdominal aorta were reported in blood flow specimens obtained from renal cell carcinomas Malign renal neoplasia, and particularly renal cell carcinoma, exhibit vascular and ... of the diastole (Fig 1B) Renal vein flow may exhibit minor changes because of changes in the right atrial and intraabdominal pressure An increased forward flow wave follows each heartbeat If the...
... useful approach and are valuable since administration is easy Much can be learned about human thought processes and problem solving methods hy contrasting natural language and proposed alternatives ... Ill-formed natural language statements, especially to novices The ambiguity of natural language may also interfere with careful thinking about the data stored in the machine An understanding of onto/into ... either a natural language facility or an alternative mode such as a query language, simple programming language, set of c o ~ a n d s , menu selection, etc Training provided with the natural language...
... call center is also available to help Chinesespeaking patients make appointments, obtain medical advice, and navigate the health care system A translation unit assures that written materials and ... call center is also available to help Chinesespeaking patients make appointments, obtain medical advice, and navigate the health care system A translation unit assures that written materials and ... and Native Americans/Alaska Natives A number of factors lead to disparities in health and health care among racial and ethnic groups, including social determinants (e.g., low socioeconomic status...
... Annals of Mathematics, 163 (2006), 969–1018 Classical and modular approaches to exponential Diophantine equations I Fibonacci and Lucas perfect powers By Yann Bugeaud, Maurice Mignotte, and ... was proved by Peth˝ o using a linear form in three logarithms [42] In the same paper he also showed that if n > and Ln = y p then p < 13222 using a linear form in two logarithms CLASSICAL AND ... combining the classical and modular approaches for Diophantine equations of the form x2 + D = y p has just been completed [13] CLASSICAL AND MODULAR APPROACHES 971 We delay presenting our lower...
... features of insulin resistance (elevated plasma insulin and apolipoprotein B concentrations and small, dense LDL particles) show a remarkable increase in CAD risk and the increased risk associated ... RAAS pathway Drugs that modulate the RAAS play an important role in advanced cardiovascular disease prevention strategies Inhibitors of the RAAS, in particular ACE inhibitors are beneficial in ... secretion is increased by elevated glucose concentrations, gastrointestinal hormones and beta(β)-adrenergic stimulation and can be inhibited by catecholamines and somatostatin Accordingly, an elevated...
... We repeated the PCFA procedure and the multiple regression analysis 10 times, each time using 81 items as training data and the remaining as test data Then we performed a correlation analysis ... only occur as leaves of the hierarchy, but also at internal nodes Following Wagner (2000) and McCarthy (2001), we created a new leaf for each internal node, containing a copy of the internal node's ... guarantees that all nouns are present at the leaf level Finally, the algorithm requires that the employed hierarchy has asingle root node In WordNet and GermaNet, nouns are not contained in a...
... relations in such an important area as food safety An agreement on the mutual development of quality and health standards and on mutual recognition of each other’ sanitary and phytosanitary measures ... for a technical regulation Thus a TBT case involving GM labeling might hinge on whether there are less trade disruptive alternative ways of informing consumers than a particular mandatory labeling ... Transatlantic Business Dialogue: Transforming the New Transatlantic Dialogue,” in Transatlantic Governance in the Global Economy, edited by Pollack, Mark, A. , and Gregory C Shaffer Lanham, MD: Rowman and...
... hypertension also lead to elevated intrarenal RI If blood pressureand heart flow are stable, an increase in heart level causes intrarenal RI to fall Tachycardia also leads to a fall in intrarenal RI (Shokeir ... similar to those in the abdominal aorta were reported in blood flow specimens obtained from renal cell carcinomas Malign renal neoplasia, and particularly renal cell carcinoma, exhibit vascular and ... of the diastole (Fig 1B) Renal vein flow may exhibit minor changes because of changes in the right atrial and intraabdominal pressure An increased forward flow wave follows each heartbeat If the...
... total, 44 full-length PSI-J sequences were aligned using CLUSTAL W In the alignment shown are the sequences from plants [Arabidopsis thaliana (ARATH) and Nicotiana tabacum (TOBAC)], algae [Chlamydomonas ... [Chlamydomonas reinhardtii (CHLRE) and Porphyra purpurea (PORPU)] and cyanobacteria [Synechcoccus elongatus (SYNEL) and Prochlorococcus marinus (PROMA)] Amino-acid residues involved in Chl binding [W ... confirmation that the aadA cassette has inserted in the psaJ gene M, marker; 1, total DNA from transgenic plant as template; 2, plasmid DNA used to transform the plants as template; 3, total DNA from...
... financial institutions on Wall Street andin the Washington, D.C area Dilip has always been an inspiration to us all and an ideal academic colleague, always energetic and enthusiastic and full of ideas, ... Unal and L Guntay) 66 Incomplete diversification and asset pricing Advances in Finance and Stochastics: Essays in Honor of Dieter Sondermann, eds K Sandmann and P Schonbucher, Springer-Verlag, ... Carr, H Geman, and M Yor) 63 Pricing average rate contingent claims Journal of Financial and Quantitative Analysis, 37(1):93–115, 2002 (with G Bakshi) 64 Option pricing using variance gamma Markov...
... dynamics in dynamin-dependent endocytosis For example, interaction between dynamin and cortactin, SH3-domain containing actin binding protein that binds also F-actin and actin-regulating Arp2/3 ... Yoshida et al., 2004), endophilin (Ringstad et al., 1997), intersectin (Zamanian et al., 2003), and sorting nexin (Ramachandran & Schmid, 2008) Actin binding proteins, such as cortactin and Abp1, also ... displacement of the labile oxalate ligand leaving group, active oxaliplatin derivatives, such as monoaquo and diaquo DACH platinum, alkylate macromolecules, forming both inter- and intra-strand...
... Yamada, K., Noda, Y., Nakayama, S., Komori, Y., Sugihara, H., Hasegawa, T., Nabeshima, T (1995) Role of nitric oxide in learning and memory andin monoamine metabolism 18 Clinical, Research and ... Chronobiological Aspects of Mood Disorders Rosa Levandovski, Ana Harb, Fabiana Bernardi and Maria Paz Loayza Hidalgo Chapter Mood Disorders in Individuals with Genetic Syndromes and Intellectual Disability ... samples, such as chest pain, headaches, abdominal pain, and arthralgia, were significantly associated with suicidal 28 Clinical, Research and Treatment Approaches to Affective Disorders ideation/risk...
... paper has presented two approaches to German parsing (n-gram based machine learning and cascaded nite-state parsing), and evaluated them on the basis of a large amount of data A new representation ... Rose, Amanda Clare, and Aaron Kotcheff 2001 A natural language system for retrieval of captioned images Journal of Natural Language Engineering, 7(2):117142 Haim Gaifman 1965 Dependency Systems and ... been in the car, if the man was asserted to be on the hill) A similar clause with 10 PPs at the ĂÂĂin on [ 1A0 0] saw ADJ, [ 1A0 1] man ADJ [ 1A1 0] saw ADJ, [ 1A1 1] man ADJ, [ 1A1 2] car ADJ heads, In...
... CGCAAGGACCTGTATTCCAACAATGTCTTATC CTGGAGGCACCACTCTGTACCCTGGTATTGC GATTAAGATTATTCCCCCCCCTGAGCGTAAATAC CTGGTATTGCTGATCACATGCAGAAGGAAATC GTGGATTAGCAAGCAAGGCTACGATGAGGCAGG HCM HCM HCM HCM HCM HCM DCM ... Pro164Ala Tyr166Cys Ala295Ser Met305Leu Ala331Pro Arg312His Glu361Gly CTCCGTGTTGCTCCCAAGGAGCACCCCACCCTG GTAACTCACAATGTCGCCATCTATGAGGGCTAC CAATGTCCCCATCTGCGAGGGCTACGCTTTGC CGCAAGGACCTGTATTCCAACAATGTCTTATC ... or chaperonin containing TCP-1 (CCT) It has previously been shown that variations in a- skeletal actin impair folding and polymerization [24], and that actin variants that are unable to fold are...
... history, examination and sputum microscopy has proved itself capable of detecting the majority of infectious cases and, in conjuction with adequate case-finding and 109 treatment, remains the backbone ... extracting DNA (Tuberculostearic acid or TSA) and increased from within the cells and this is one of the production of host enzymes (Adenosine Deaminase) important limiting factors in determining ... orginally and later developed resistance because of inadequate or inappropriate chemotherepy The latter are generally referred to as having ‘acquired’ drug resistance A better term for ‘primary’...