and c terminal cdk4 regions for tax binding in vitro

Báo cáo y học: " Dicistronic MLV-retroviral vectors transduce neural precursors in vivo and co-express two genes in their differentiated neuronal progeny" potx

Báo cáo y học: " Dicistronic MLV-retroviral vectors transduce neural precursors in vivo and co-express two genes in their differentiated neuronal progeny" potx

Ngày tải lên : 13/08/2014, 09:21
... injected MLV-vector producer cells Location of injected MLV-vector producer cells Injected helper cells were found mainly in the hind brain beneath the caudal cerebellum The red line in A indicates the ... brain The micrographs shown (Fig 2C to 2G) were produced from adjacent coronal sections of caudal cerebellum and the underlying hindbrain, in the regions indicated (Figure 2A and 2B) Injected cells ... nuclei typical of neural cells Injected producer cells were not restricted to the injection site since histochemically labelled producer and control cells were also found at different sites including...
  • 12
  • 225
  • 0
Báo cáo y học: "Between adaptive and innate immunity: TLR4-mediated perforin production by CD28null T-helper cells in ankylosing spondylitis" pptx

Báo cáo y học: "Between adaptive and innate immunity: TLR4-mediated perforin production by CD28null T-helper cells in ankylosing spondylitis" pptx

Ngày tải lên : 09/08/2014, 07:20
... PCR amplification was performed on µg total RNA and 10 pmol primers (TLR2: forward, 5'-GGCCAGCAAATTACCTGTGTG-3'; reverse, 5'-CTGAGCCTCGTCCATGGGCCACTCC-3'; TLR4: forward, 5'TGCAATGGATCAAGGACCAGAGGC-3'; ... 5'TGCAATGGATCAAGGACCAGAGGC-3'; reverse, 5'GTGCTGGGACACCACAACAATCACC-3'; and β2 microglobulin: forward, 5'-CTCCGTGGCCTTAGCTGTG-3'; reverse, 5'-TTTGGAGTACGCTGGATAGCC-3') using the HotStar Master Mix Kit (Qiagen Valencia, ... peripheral veins after informed and written consent according to the local ethics committee Patients' characteristics (including age, sex, the presence of rheumatoid factor and anti-cyclic citrullinated...
  • 9
  • 263
  • 0
Báo cáo y học: "Polarized subsets of human T-helper cells induce distinct patterns of chemokine production by normal and systemic sclerosis dermal fibroblasts" doc

Báo cáo y học: "Polarized subsets of human T-helper cells induce distinct patterns of chemokine production by normal and systemic sclerosis dermal fibroblasts" doc

Ngày tải lên : 09/08/2014, 07:20
... metastasis formation and fibrosis [10] For instance, MCP-1/ CCL2 – a CC chemokine that binds to CC chemokine receptor (CCR)2 – has attracted keen interest in the field of fibrosis because it appears ... including the CC chemokines RANTES [23], MIP-1α [24], PARC (pulmonary and activation-regulated chemokine)/CCL18 [25] and MCP-3/ CCL7 [26], and CXC chemokines IL-8/CXCL8, GRO (growth regulated oncogene)-α/CXCL1 ... [4-8] Chemokines are soluble mediators that were originally identified because of their chemotactic properties in cells expressing specific receptors Indeed, chemokines that influence chemotaxis...
  • 12
  • 388
  • 0
Báo cáo y học: "CCR3, CCR5, CCR8 and CXCR3 expression in memory T helper cells from allergic rhinitis patients, asymptomatically sensitized and healthy individual" docx

Báo cáo y học: "CCR3, CCR5, CCR8 and CXCR3 expression in memory T helper cells from allergic rhinitis patients, asymptomatically sensitized and healthy individual" docx

Ngày tải lên : 13/08/2014, 13:22
... Minota S: Characterization of chemokine receptor expression and cytokine production in circulating CD4+ T cells from patients with atopic dermatitis: up-regulation of C- C chemokine receptor in ... antibodies: CCR3-FITC, CCR5-FITC, CCR8-FITC, CXCR3FITC (R&Dsystems, Abingdon, UK), CD4-PE-Cy5 and CD45RO-PE (Dakocytomation, Glostrup, Denmark) Three-color flow cytometry was performed on day and day ... the PBMCs, the cells were subjected to flow cytometric analysis No significant differences in the percentage of CCR3+, CCR5+, CCR8+ and CXCR3+ memory Th cells from allergic, asymptomatically sensitized...
  • 6
  • 181
  • 0
Helper T Cells docx

Helper T Cells docx

Ngày tải lên : 01/08/2014, 19:20
... kh c để chemokine Và họ làm   bày tỏ tế bào Th1 chemokine CCR5 (nhưng không CCR3) Th2 tế bào thụ c m thể chemokine CCR3 (nhưng không CCR5) CCR3 Một chemokine mà liên kết với CCR3 gọi eotaxin ... bào c thụ thể kh c chemokine Chemokine cytokines chemotactic cho (thu hút) bạch c u C c thành viên nhóm, người chia sẻ c p cysteine liền kề (C) dư lượng gần N thiết bị đầu cuối họ, thiết kế chemokine ... chemokine CC Chemokine gắn vào thụ thể bạch c u đáp ứng C c thụ thể protein xuyên màng với trang web liên kết chemokine tiếp x c bề mặt màng huyết tương chemokine thụ CC định CCR Với ch c kh c họ,...
  • 9
  • 215
  • 0
Báo cáo y học: "Differentiation of naive CD4+ T cells towards T helper 2 cells is not impaired in rheumatoid arthritis patients" pps

Báo cáo y học: "Differentiation of naive CD4+ T cells towards T helper 2 cells is not impaired in rheumatoid arthritis patients" pps

Ngày tải lên : 09/08/2014, 01:23
... effector Th cells Factors that drive the initial expression of IL-4 (as the major Th2-defining cytokine) in human naive CD4+ T cells include costimulation via CD28 in concerted action with TCR engagement ... den Berg WB: Role of interleukin-4 and interleukin-10 in murine collagen-induced arthritis Protective effect of interleukin-4 and interleukin-10 treatment on cartilage destruction Arthritis Rheum ... M: Interleukin-7 activates human naive CD4+ cells and primes for interleukin-4 production Eur J Immunol 1997, 27:633-640 28 Appasamy PM: Biological and clinical implications of interleukin-7 and...
  • 8
  • 269
  • 0
Báo cáo khoa học: " A simple and rapid Hepatitis A Virus (HAV) titration assay based on antibiotic resistance of infected cells: evaluation of the HAV neutralization potency of human immune globulin preparations" potx

Báo cáo khoa học: " A simple and rapid Hepatitis A Virus (HAV) titration assay based on antibiotic resistance of infected cells: evaluation of the HAV neutralization potency of human immune globulin preparations" potx

Ngày tải lên : 12/08/2014, 04:21
... killed uninfected cells Since the HAV-Bsd-infected Huh7-A-I cells, but not the uninfected cells, continued to metabolize and acidify the cell culture media in the presence of blasticidin, the color ... severe form of hepatitis A, which in some rare instances can result in fulminant hepatitis In developing countries, water- and food-borne HAV infections are common during childhood, which induces ... HAV) containing a A216V amino acid substitution in the 2B protein was used as the background to construct HAV-Bsd The blasticidin resistance (Bsd) gene coding for the blasticidin deaminase was inserted...
  • 9
  • 297
  • 0
Báo cáo y học: " Natural killer cells control a T-helper 1 response in patients with Behçet''''s disease" doc

Báo cáo y học: " Natural killer cells control a T-helper 1 response in patients with Behçet''''s disease" doc

Ngày tải lên : 12/08/2014, 12:20
... PBMCs were incubated with the following combination of fluorescently labeled mAbs: anti-CD56-fluorescein isothiocyanate, anti-CD69-phycoerythrin-cyanin 5.1, and anti-CD3-allophycocyanin (Beckman-Coulter, ... Gladbach, Germany) as CD14-CD3-CD56+ cells [15] Namely, the CD14+ cells and CD3+ cells were depleted from PBMCs by incubation with anti-CD14 and anti-CD3 mAb-coupled magnetic beads, and then the CD56+ ... in 10 cases and inactive (iBD) in 37 cases at the time of blood sampling Active disease was defined as flare of characteristic BD symptoms, including severe skin, mucosal, and/ or ocular involvement...
  • 9
  • 323
  • 0
Báo cáo y học: " Expansion of CD4+CD25+ helper T cells without regulatory function in smoking and COPD" potx

Báo cáo y học: " Expansion of CD4+CD25+ helper T cells without regulatory function in smoking and COPD" potx

Ngày tải lên : 12/08/2014, 13:22
... identify CD3+, CD4+, CD25+ and CD127+ cells, the cells were stained with Allophycocyanin (APC) conjugated anti-human CD3, fluorescein isothiocyanate (FITC) conjugated anti-human CD4, phycoerytrin-Cy5 ... physical characteristics in a region according to their characteristic forward scatter (FCS) and side scatter (SSC) profiles, as previously reported [6] 3,000 total events were collected in CD3+ ... staining of FoxP3 was conducted according to the recommended procedure obtained from eBioscience (San Diego, CA, USA) Cells were permeabilised with eBioscience FoxP3 Staining Buffer Set at 4 C for...
  • 8
  • 302
  • 0
Báo cáo y học: " Antigen-sensitized CD4+CD62Llow memory/effector T helper 2 cells can induce airway hyperresponsiveness in an antigen free setting" pptx

Báo cáo y học: " Antigen-sensitized CD4+CD62Llow memory/effector T helper 2 cells can induce airway hyperresponsiveness in an antigen free setting" pptx

Ngày tải lên : 12/08/2014, 18:21
... These findings suggest that T cells, especially CD4+ Th2 cells, are also important for the AHR induction However, in these studies, AHR induced by CD4+ Th2 cells accompanies eosinophilic airway inflammation ... Raw Increasing doses of Mch were administered by ultraneblization for minutes The concentration of Mch that induced a 100% increase in Penh or Raw was expressed as PC200Mch (µg/ml) or PC200Mch ... applied and incubated at 37 C for 30 minutes After washing, avidin-biotin peroxidase complex was applied and incubated at 37 C for 30 minutes, followed by the addition of diaminobenzidine solution Color...
  • 16
  • 179
  • 0
Báo cáo y học: " Targeted infection of HIV-1 Env expressing cells by HIV(CD4/CXCR4) vectors reveals a potential new rationale for HIV-1 mediated down-modulation of CD4" doc

Báo cáo y học: " Targeted infection of HIV-1 Env expressing cells by HIV(CD4/CXCR4) vectors reveals a potential new rationale for HIV-1 mediated down-modulation of CD4" doc

Ngày tải lên : 13/08/2014, 09:21
... GGGATATTGATGTCTGTAGAATAGGAGCTTTGTTCCTTGGG and (-) CCCAAGGAACAAAGCTCCTATTCTACAGTCATCAATATCCC produced a 1457 bp fragment with a 1448 bp deletion in Env (pos 6307–7755) It was cleaved with EcoRI and HpaI (C) : ... 7705 in pNL4-3 using the fusion primer CCCCGGTGCAGCCAATGATTGAACCATTAGGAGTAGC and the terminal primers AAGCTTGGTTACCCAGGACC and GGAGTGTATTAAGCTTGTG The fusion product was ligated at HindIII to gp41, ... of the chimeric CD4 proteins in an increased number of cells Co-infection of the cells with a vaccinia virus recombinant encoding the HIV-1 Env provided the cell fusion function Syncytia formation...
  • 15
  • 241
  • 0
Strings and Vectors

Strings and Vectors

Ngày tải lên : 12/09/2012, 22:51
... 28 C- strings to Integers  To read an integer as characters  Read input as characters into a C- string, removing unwanted characters  Use the predefined function atoi to convert the C- string ... function  Syntax for using this getline is different than that used with cin: cin.getline(…) Syntax for using getline with string objects: getline(Istream_Object, String_Object); Copyright © 2007 ... getline is cin.getline(String_Var, Max_Characters + 1);   cin can be replaced by any input stream Max_Characters + reserves one element for the null character Copyright © 2007 Pearson Education,...
  • 92
  • 410
  • 1
Báo cáo y học: " Effect of Weight Reduction on Cardiovascular Risk Factors and CD34-positive Cells in Circulatio"

Báo cáo y học: " Effect of Weight Reduction on Cardiovascular Risk Factors and CD34-positive Cells in Circulatio"

Ngày tải lên : 25/10/2012, 10:51
... body mass index (BMI) Blood chemistry parameters, including glucose, cholesterols, triglycerides and circulating CD34-positive cells were measured for nine subjects at the beginning and at the ... cells Our decision to considered CD34 positive/CD45 negative circulating cells as “circulating EPCs” was based on the work [28], in which blood–derived cells from which endothelial cells in culture ... hematopoietic properties [29] Specific cell surface staining was accomplished by incubating duplicate samples of a biological specimen (separated white blood cells) with two color CD45-FITC/CD34-PE...
  • 8
  • 594
  • 0
Báo cáo y học: "Positioning Effects of KillerRed inside of Cells correlate with DNA Strand Breaks after Activation with Visible Light"

Báo cáo y học: "Positioning Effects of KillerRed inside of Cells correlate with DNA Strand Breaks after Activation with Visible Light"

Ngày tải lên : 25/10/2012, 11:15
... understanding of the cellular structure and function mechanisms In this context the fluorescent proteins absorbing daylight and producing ROS come as tools for research into the increasing field ... Natl Acad Sci U S A 2002; 99: 4424-9 39 Albiez H, Cremer M, Tiberi C, et al Chromatin domains and the interchromatin compartment form structurally defined and functionally interacting nuclear ... surrounding partners (resulting in marred proteins and strand breaks in nu- 103 cleic acids) [43-45] underlining the imperative for a delivery of the therapeutic plasmid DNA encoding ROS producing...
  • 9
  • 390
  • 0
Báo cáo y học: " Helicobacter pylori induces mitochondrial DNA mutation and reactive oxygen species level in AGS cells"

Báo cáo y học: " Helicobacter pylori induces mitochondrial DNA mutation and reactive oxygen species level in AGS cells"

Ngày tải lên : 25/10/2012, 11:18
... ATPase6 COX-I COX-II COX-III Cyt b Forward primer (5’→3’) ATTCTAACCTGAATCGGAGG CCCGGACGTCTAAACCAAACC AATTACCCCCATACTCCTTACACT CCTCGGAGCTGGTAAAAA ACTACCCCGATGCATACACCACA GCCGTACGCCTAACCGCTAACA CGCACGGACTACAACCACGAC ... CGCACGGACTACAACCACGAC Reverse primer (5’→3’) GATGCTTGCATGTGTAATCT GGGGATCAATAGAGGGGGAAATA GGGTCATGGGCTGGGTTTTACTAT GGGGGTTCGATTCCTTC GGGCAATGAATGAAGCGAACAG TCGTAAGGGGTGGTTTTTCTATG GGACAGGCCCATTTGAGTATTTTG ... excision repair and mismatch repair are down-regulated both in vitro and in vivo Moreover, Hp induces genomic instability in nuclear CA repeats in mice and in mtDNA of AGS cells and chronic gastritis...
  • 12
  • 557
  • 2
Báo cáo y học: "ntravenous transplantation of allogeneic bone marrow mesenchymal stem cells and its directional migration to the necrotic femoral head"

Báo cáo y học: "ntravenous transplantation of allogeneic bone marrow mesenchymal stem cells and its directional migration to the necrotic femoral head"

Ngày tải lên : 25/10/2012, 11:18
... local ischemic tissues, and thus a lot of chemotatic factors including interleukin-8 (IL-8), monocyte chemoattractant protein (MCP-1), stromal cell-derived factor (SDF-1) and tumor necrosis factor ... Stem cells circulate among tissues, and stem cells migrate to the injured tissues once injury occurs Stem cell homing is a complicated process in which a lot of molecules were involved Once tissues ... and allogeneic MSC into baboons, and no toxic reactions were observed during 1-year follow-up [41] Another intravenously injected allogeneic macaque MSCs into macaques or MSCs were directly injected...
  • 10
  • 584
  • 0
Báo cáo y học: "Association between regulated upon activation, normal T cells expressed and secreted (RANTES) -28C/G polymorphism and asthma risk – A Meta-Analysis"

Báo cáo y học: "Association between regulated upon activation, normal T cells expressed and secreted (RANTES) -28C/G polymorphism and asthma risk – A Meta-Analysis"

Ngày tải lên : 26/10/2012, 09:39
... eosinophil-active cytokines such as interleukin-5, granulocyte macrophage colony-stimulating factor, and interleukin-3), which contributes to the bronchial mucosal accumulation of activated eosinophils ... we calculated the ORs of the polymorphism (GG+CG versus CC, and GG versus CG+CC), using both dominant and recessive genetic models of the variant G allele In addition, we conducted stratification ... Respir Crit Care Med 1996; 153: 1398-404 27 Humbert M, Ying S, Corrigan C, et al Bronchial mucosal expression of the genes encoding chemokines rantes and mcp-3 in symptomatic atopic and nonatopic...
  • 7
  • 525
  • 0
Báo cáo y học: "High-Resolution Flow Cytometry: a Suitable Tool for Monitoring Aneuploid Prostate Cancer Cells after TMZ and TMZ-BioShuttle Treatment"

Báo cáo y học: "High-Resolution Flow Cytometry: a Suitable Tool for Monitoring Aneuploid Prostate Cancer Cells after TMZ and TMZ-BioShuttle Treatment"

Ngày tải lên : 26/10/2012, 09:48
... atelocollagen: Combined therapy using siRNA targeting Bcl-xL and cisplatin against prostate cancer Int J Cancer 2009;125(12):2978-90 Cherry J, Karschner V, Jones H, and Pekala PH HuR, an RNA -binding ... EJ, and Jenkins RB Clinical significance of alterations of chromosome in high-grade, advanced, nonmetastatic prostate carcinoma J Natl Cancer Inst 1999; 91: 1574-1580 59 Emmert-Buck MR, Vocke CD, ... is well documented that both cell cycle phase points G1 and G2/M represent check points for control and repair maintaining the genomic DNA-integrity.[49-51] Therefore among other things, both...
  • 10
  • 408
  • 0
 Báo cáo y học: "Why are some children with early onset of asthma getting better over the years" -aneuploid-prostate-cancer-cells-after-tmz-tmz-bioshuttle-treatment.html#post143974

Báo cáo y học: "Why are some children with early onset of asthma getting better over the years" -aneuploid-prostate-cancer-cells-after-tmz-tmz-bioshuttle-treatment.html#post143974

Ngày tải lên : 26/10/2012, 09:48
... database and statistically analysed using the SPSS version 14.0 programme (SPSS Inc., Chicago, IL, USA) Significance of differences was assessed by the Chi2-method for categorical variables and for continuous ... a correlation matrix was initially made for all independent variables in order to determine which indicators to be included in the final model For those variables that were inter-correlated and ... Duhme H, Chambless L The international Study of Asthma and Allergies in Childhood (ISAAC): objectives and methods; results from german ISAAC centres concerning traffic density and wheezing and allergic...
  • 10
  • 456
  • 0
Báo cáo y học: "Proteomic analysis of mechanisms of hypoxia-induced apoptosis in trophoblastic cells"

Báo cáo y học: "Proteomic analysis of mechanisms of hypoxia-induced apoptosis in trophoblastic cells"

Ngày tải lên : 31/10/2012, 15:12
... trophoblastic cells Materials and methods Cell line and cell cultures The human choricarcinoma cell line JAR was obtained from American Type Culture Collection (Manassas, VA, USA) Cells were maintained in ... follows: 94 C for min, 30 cycles of 94 C for 45 sec, 68 C for 45 sec, and 74 C for min, with final extension at 74 C for The integrity of the RNA used for RT-PCR was confirmed using GAPDH synthesis ... et al Docetaxel Induced Gene Expression Patterns in Head and Neck Squamous Cell Carcinoma Using cDNA Microarray and PowerBlot Clin Cancer Res 2002; : 3910-3921 10 Spencer K., Yu CKH., Cowans NJ.,...
  • 9
  • 499
  • 0

Xem thêm