... understanding oftheanatomyand function ofthe ear andthe auditory nervous system, and it discusses the cause and treatment of hearing disorders Most books on hearing focus either on theanatomy ... original work on the different subjects Understanding oftheanatomyandthe function ofthe auditory system together with knowledge about the pathophysiology ofthe auditory system are essential ... function ofthe cochlea than of any other sensory organ C H A P T E R Anatomyofthe Ear ABSTRACT 10 The ear consists ofthe outer ear, the middle ear andthe inner ear The outer ear consists of the...
... at the entrance ofthe ear canal compared with the sound pressure that is measured in the place ofthe head The effect ofthe head on the sound at the entrance ofthe ear canal is related to the ... ratio between the effective area ofthe tympanic membrane andthe area ofthe stapes footplate, but the lever ratio ofthe middle ear bones also contributes The ratio of areas ofthe BOX 2.2 SOUND ... remarkable in the light ofthe FIGURE 2.12 (A) Average displacements ofthe umbo, the head ofthe stapes andthe lenticular process ofthe incus (B) The lever ratio at 124 dB SPL at the tympanic...
... anatomyandphysiologyofthe auditory nervous systemof clinical importance Most studies ofthe function ofthe auditory system have aimed at the coding of different kinds of sounds in the auditory ... in the ventral parts ofthe MGB ofthe thalamus, the nonclassical sensory pathways use the dorsal and medial division ofthe MGB as relay (Fig 5.10) [122] These divisions ofthe MGB receive their ... ofthe fourth ventricle (Fig 5.15B) [72] The other part ofthe olivocochlear system projects mainly to the contralateral cochlea andthe fibers of that system travel deeper in the brainstem The...
... The caudal portion ofthe floor ofthe lateral recess is the (dorsal) surface ofthe dorsal cochlear nucleus andthe rostral portion ofthe floor ofthe lateral recess is the dorsal surface of ... difference between the latency ofthe N1 ofthe AP and that ofthe response from the intracranial portion ofthe auditory nerve is the travel time in the auditory nerve from the ear to the recording ... the latency ofthe first peak in the dipole andthe length is the relative strength ofthe dipoles Note the short distance between the two first dipoles (peak I and II ofthe ABR) andthe third...
... and standard error ofthe mean are shown as a function ofthe intensity ofthe noise The TTS was measured 20 s after the end ofthe exposure In this study the noise exposure consisted of a band ... basis ofthe elevation ofthe hearing threshold in disorders ofthe middle ear andthe cochlea but the effect on the function ofthe nervous system may affect speech discrimination Impairment of speech ... decreases the input to the cochlea and thereby decreases the contraction ofthe stapedius muscle, and that in turn causes the input to the cochlea to again increase, and that increases the contraction...
... increase the sensitivity and frequency selectivity ofthe ear (cf Chapter 3) The widening ofthe tuning ofthe basilar membrane broadens the “slices” ofthe spectrum of broad band sounds from which the ... noninvasively The outcome ofthe test depends on fine details oftheanatomyofthe stapes and its suspension in the oval window, the incudo-stapedial joint andthe orientation of its plane surface ... this view of flexibility ofthe function ofthe auditory system That injury and loss of cochlear hair cells can cause profound changes in the structure and function ofthe central auditory system...
... tinnitus and abnormal perception of sounds such as hyperacusis and phonophobia) are some ofthe most diverse and complex disorders ofthe auditory systemand their causes are often obscure Often ... corresponding to the F1 frequency andthe other corresponding to the frequency of F2 The rate ofthe impulses is that of F0 for voiced sounds, and a quasi-random rate (average of 100 pps) for ... determined on the basis ofthe output of 16 band-pass filters The output ofthe six band-pass filters with the largest amplitudes is coded in the impulses that are applied to the electrodes in the cochlea...
... H Shimano Physiologyand pathophysiology ofthe SREBP family SREBP-1c and lipogenesis The SREBP family consists of three isoforms: SREBP1a, SREBP-1c, and SREBP-2 Each isoform has a different ... Physiologyand pathophysiology ofthe SREBP family H Shimano at G1 [19] In particular, p21 is a direct target of SREBP [20] The role of SREBP-1a in the regulation of cell growth andthe cell cycle ... adipogenesis and obesity associated with insulin resistance [48] The exact roles of SREBP-1c ⁄ ADD1 are not yet fully defined SREBP and parasympathetic function in heart Parasympathetic stimulation of the...
... out of 44 variants andthe passive system from 14 out of 22 The entire active system is learnable once examples of each form of each verb and each modal have been seen, plus one example to fix the ... force the separate tre.atment of active versus passive forms Then if, say on considerations of frequency of occurrence, exceptions were externally handled andthe infrequent The auxiliary system ... inferential power andthe proper handling of exceptions For l-reversible inference, 45 ofthe verb sequences of length three or shorter will yield the remaining nine such strings and nonc longer...
... the company of his young lady friend—through the pressure of her hand upon his arm, the lithe, graceful movement of body and limbs, the smile, the light in the eye andthe soft voice All of these ... Summary of Principles 24 a The propagation of offspring andthe protection and support ofthe young and defenseless, always involve sacrifice on the part 24 ofthe parents andthe stronger members of ... movements and partly by the action ofthe cilia in the ducts ofthe epididymis andthe peristaltic contractions ofthe vas deferens—hurried along the vas to the ampulla If the period of sexual...
... ofthe other pathologies as well as contributed to the writing ofthe rest ofthe manuscript SMM provided cross species analysis and contributed to the writing ofthe manuscript RMG wrote and ... alteration of a normal cell; promotion involves both proliferation of initiated cells and suppression of apoptosis of these cells; and progression is the irreversible conversion of one ofthe promoted ... verifying the effects of E2 in all systems and integrating the contents ofthe paper provided by other coauthors DRP wrote and provided content in relation to breast cancer and epidemiologic review of...
... control ofthe vascular inflammation and disruption of endothelium, allowing the passage ofthe virus in the organs The early NiV infection of endothelial cells importantly upregulated the chemokines ... allow the second cycle of replication ofthe virus andthe viremia NiV infection is characterized by the formation of syncytia leading to the endothelial damages, which are thought to be the cause ... GTCCACCACCCTGTTGCTGTAG The relative expression represents the ratio ofthe number of copy of mRNA of interest versus mRNA of GAPDH All calculations were done using the 2CT model of (Pfaffl, 2001) and experiments...
... experts in the field ofthepathologyofthe head and neck As such they are the main members ofthe Working Group on Pathologyofthe Head and Neck ofthe European Society of Pathology, one ofthe first ... description ofthe manifold aspects ofthe morphology andpathologyofthe organs ofthe head and neck region These description, as comprehensive as they may be, also show that there are some areas ofthe ... Head and Neck” is that the proximity ofthe organs ofthe head and neck region makes it difficult for the surgical pathologist to focus on one of these organs and neglect thepathologyof others,...
... present Both the nuclear grade ofthe lesion andthe Bloom-Richardson grade were two based on the overall appearance ofthe tumor The lymph nodes were negative The tumor was staged as T1N0M0 and was ... tumors Chemotherapy seems to have a significant role in the treatment of mixed ACC ofthe breast, not only due to the lack of hormone receptors but also because ofthe aggressiveness ofthe non-ACC ... the histological examination ofthe specimen and contributed to the writing ofthe manuscript All authors read and approved the final manuscript Competing interests The authors declare that they...
... case of MZ with mirror-imaging of AC in the literature In this case, we describe the second case of MZ with mirror-imaging of AC and discuss the possible clinical implications First, Helland and ... lack of systematic monitoring and follow-up Therefore, a large percentage of patients with AC are probably undiscovered Mirror images, on the other hand, are present in approximately 25% of MZ Therefore, ... consider that it is mandatory to monitor the counterpart ofthe symptomatic patient with AC as early as possible, irrespective ofthe absence of symptoms Conflict of Interest The authors have declared...
... craniotomy because ofthe proximity ofthe sinus to the orbit andthe anterior skull base [5] The frequency of bilateral absence ofthe frontal sinus has been reported in 3-4% to 10% of several populations ... reliability between observers and was 0.86 Fig Unilateral absence ofthe frontal sinus; on the right, the absence ofthe frontal sinus, and on the left, the limited aeration ofthe frontal sinus; axial ... sinuses, although there is only one frontal sinus ostium The size ofthe sinus and, therefore, its anatomic relationships also depend upon the extent of pneumatization [11] The extent of pneumatization...
... occurrence ofthe tumor corresponded exactly one to the other; and (4) there was a more than one year interval between trauma andthe appearance ofthe tumor As regards the pathogenesis of post-traumatic ... time interval between trauma andthe appearance ofthe tumor of at least year, a longer latent period increasing the likelihood of a causal relationship The presence ofthe tumor must be proved histologically ... at the time ofthe trauma demonstrating significant injury andthe follow-up scans demonstrating tumor at the same site4 With the routine use of CT and magnetic resonance imaging (MRI), some of...
... circumstances In the resolutions ofthe VIth andthe VIIth congresses ofthe Communists Party and those ofthe important meeting ofthe National Assembly, the Government andthe Central Party ... building up the whole system It is hoped that these schools (10-15% ofthe sector) will reach the standards ofthe best institutions in the region and gradually those ofthe world While these school ... assessment the demand of skilled labor and how to solve the gap between demand and supply of skilled labor for sustainable economic growth in Vietnam Objectives ofthe Study The objectives ofthe study...
... component of most management definitions of strategy Strategy is the determination ofthe basic long-term goals and objectives of an enterprises, andthe adoption of courses of action andthe allocation ... features 60 As a rule, then, the lower the price of substitutes, the higher the quality andthe performance, andthe lower the user’s switching costs, the more intense are the competitive pressures ... market conditions in the supplier industry andthe significance ofthe item they supply The competitive fore of suppliers is greatly diminished whenever the item they provide is a standard commodity...